Transcript asmbl_779

Sequence
Transcript Sequence for observation asmbl_779 of TGE0007654:
ATATAAAGGTCCGCCCTGGACTGGCCCAAGACAGTTTGGGAGTCAACTTTAAAGTCGTTGTCGCCGCACCCCGGACGTCCCGCTGACCGCGTGCGTGCTTCTGAGAAATGTCTACCAACGAGACAGAAGCCCCTGCCAACACCCATGTGACAGCAGAAGAACCGGTACAGCAGCCCAGCGTGGTGGACCGCGTGGCCCACATGCCCCTTATCGGTGCCACCTGTAATATGGTGTCCGCGGCCTACACCTCCACCAAGGAGAGCCACCCCCACGTCAAGACCGTCTGCGAAGCGGCGGAAAAAGGTGTGAAGACCCTCACAGAGGCTGCCATCAGCGGGGCCCAGCCCATCCTGTCCAAGCTGGAGCCTCAGATCGCATTGGCCAGTGAATACGCCCACAAGGGGCTGGATAAGCTGGAGGAGAACCTGCCCATCCTGCAGCAGCAGACGGAGAAGGTCCTGGCAGACACCAAGGAACTCGTGTCATCTAAGGTATCGGGGGCCCGAGACGCCATGTCCAGCACGGTGTCCAGCGCCAAGGACGCAGTGGCCGCCCGAGCGACAGGGGCAGCAGATGCGACCCGGGAAGCCATGCAGAGTGGCGTGGACATGACCAAGTCGGTGGTGACCAACAGTGTCCAGTTGGTGGGCCAGATGGTGCTGAGCGGGGTGGATACGGTGCTGGGCAAGTCGGAGGAGTGGGCGGACAACCACCTGCCCATGACGGACTCCGAGCTGGGTGAGTGTGGCCCGCGGGCCAGCCCCCACCCCGACACCCCCACGCAGAGTCCGTCGGTTTGAATGACATTTAAATGAACAAATAAATGGCCGGTGGGTGAGGGGAAGAACAGAGGAGAGTCTGAGTGATTTAATTCAGGGATCTGGACACCTGCTGAGTCCCGGGCCCGATCCTAGACATAGGGACACAAGCAGTGAGCAGGCTGGAGGACGGAATCCATGACCAATTCTGGAAAGAAAAAAC