Transcript asmbl_75751

Sequence
Transcript Sequence for observation asmbl_75751 of TGE0007664:
GGCGGGTCCACTTTCCGGGTGACTCATGTCGTTACTATTTGTCTTTTGTTTCTAGGATGCTTTGGCTGCAATTTTCTTCCCTTTGTTTTTAATTTGGGAGGAGAAAAAGCTAATGAATCAAGAATGAATCTTCTCTCCACTAACCTTTTCTTTTCTTTCTTAAAGTTGGTTCTCTCTTCTCACAAGTTCCATAACTGTTAAGATGTGCGGGGGCGGGACAGGTGGGGACGCACTCTTTACACCTAAATCTGAAGTTGGCGCCTAAGGTATCACTTTGATGTGTGAATCGGGGTGAATTCCACGAGATTCACTAGCGGATTTGTTCCTGTCCAAGGAGGAGGCGCGCAGCGCTGATCCCCTCCAGTCTCCTTTCTCAAATCTCCCTGCGGAGGGCTGTCAAGGTTGGCCGCGCGGCAGAAGTCCCTCTGGCCGGCCTAACCCTCCCCTGCCCCCAGGTTGGTTTTTCCCAGCTGCGGAGGTTGGGCCAGGGGCTGGGGTACTAGGAGAGTCAGCGACCGCCGCGCGGAGCTGGAAAGTCGCCGCGACTCCGGTGGGACTCGGAGTTGTCTCTGGAGGTGGCGGGCGCGGAGGTGAGCGGTTGGGAGCTAGCGGCGCAGGCGAGAATCGGGAGGCGGCGCCGGGGCCCCTCCCATCCTCTGGCGGGAGAGTAACCTAGGTCCCGGGTTTCACCGCTGCTTTGTTCGCGGCCTCTTCCCTCCCATTTGGAGATGACTGGAACCCCCTCTGGGATCCGAGGAGCAGGCGAAGGCTCGGGCTGGGGTGGGGGTGGGGTGTCATCTGCTGTAGGGTCCTTTGCTTTCTGTTAATCCGAGAGGGTACAAAAAGACATGAGAAGACGCTTGTAACCTGAAACTTCCCTCTCATCCATCTGGACCTGGAGGAGAGGTCCGGGCGGGGGCGCAGACCCGGAAGGCTGGTCGTCAGCGGAGGCGGTCCTGCAGCGGATCCAGCGCAAGGCGCCAACAAAAGAGGCGAGGAGGTGGCAACCCGGGGGCGGCGGCAGGAAGAGGAGCGGGAGTTGAGTGTCCACACCCGCTGTGCGTACTTTCTAGAGGGAAGGGGCGGGGGAATCGGCCCTGGGAGGAGGACATCCGGTGGTCAAGGGGTTAGCCAAGTTCTGGTTGCTGAGCCCTCCCACGAGAGGAAAGTTTTCTCTAGACACCTCCGGCCGACCCGCGCTCTCCGGGCCCAGCTCCCGAGCCTTCGGAGCGGGCTCTGTCCCAGCCCAGCTCCGGGGAGACCCGTGCCGTGATGCCTGGGGGGTGCTCCTGGGGCCCCGCCGCCGGGGACGCTCGGCTGTGGCTGGCGGTGGTCCTCCTGGGCTGGGTCACCTCGTCCTCACTCACCTCCTCGGCGACGTCCTCCACCTCCTCCGCGCAGTTCCTGGCCTCCGCGGTGTCCGCACAGCCCCCGCTGCCAGGCCAGTGCCCCCCGCCATGCGAGTGCTCCGAGGCGGCGCGCACCGTCAAGTGCGTTAACCGCAACCTGACCGAGGTGCCAGCGGACTTGCCCCCTTATGTGCGCAACCTCTTCCTCACCGGCGATCAGCTGGCGGTGCTCCCTGCCGGCGCCTTCGCCCGCAGACCGCCGCTGGACGAGCTGACCGCGCTCAACCTCAGCGGCAGCCGCCTAAAGGAGGTGCACGCTGGCGCCTTCGAGCAACTGCCCAGCTTGCGCCAGCTCGACCTTAGCCACAACCCGCTGGACGACCTCAGCCCCTTCGCTTTCTCGGGCAGAAACGCCAGCGCCTCTGCCCCCAGCCCTCTGGTGGAACTGTTCCTGAACCACATCCTGCCTCCTGAGTTCGATCGAGAGAACCGTAGCTTCGAAGGTATGGTGGCAGCGGCCCTGCGAGCTGGCCAGGCTCTGCGCGGGCTCCACCGCCTGGAGCTGACCAGCAACCACTTGCTCTATCTGCCCCGCGACGTACTGGCACAAATGCCGGCCCTTAGGCACCTGGACCTGCGTAACAACTCGTTGGTGAGCCTGACTTATGTGTCCTTCCGCAACCTGACACACCTAGAAAGCCTCCACCTGGAGGACAACTCCCTCAAGGTCCTTCATAACGGCACCCTGGCAGAGTTGCAGGGCCTGCCCCAAGTCAGGGTCTTTCTGGACAACAATCCCTGGGTATGCGACTGCCACATGGTGGACATGGTGGCCTGGCTCAAGGAGACAGAGGTCGTGCAGGGCAAAGCTAGGCTCACCTGTGCATTCCCTGAAAAAATGAGGAATCGGGTCCTCTTGGAACTCAACAGCTCAGACCTGGACTGTGATCCTATCCTCCCTCCATCCCTGCAGACTTCTTATGTCTTCCTAGGTATTGTTTTAGCCCTGATAGGCGCGATTTTCCTACTGGTTTTGTATTTGAACCGCAAGGGGATAAAAAAGTGGATGCATAACATCAGAGATGCCTGCAGGGATCACATGGAAGGGTATCATTACAGATATGAAATCAATGCGGACCCCAGGTTAACAAACCTCAGTTCTAATTCGGATGTCTGAGAGACAATCGAGGACAAAACAAGGACAGCTATGCATGAGATGTAGACTTAAGCTTTATCTCATCCTATGCTTGCTCCATCTCCACTATCCACTATAGACACCACTGACCTTGACTGAAAGCAGTGAAGGGACTTTCCTTCCTTGTCATGTAAAGTTTTTTGGTGTGTTCTATTACTGTAAGATGATAAACAATTGCATAGTCTTTTACCTTCTTCCTTTTCTTGGAACTCCTTAATACAGGTGGAGGGATTTTTCAAGTTTCAGCATGAACATGGACTCCTGGCTGTCTGTTTCTCTTAGCACACACAGTTCAAGGTGTAGCAAGTGTACCCACACAGACAGCATTCAACAAAAGCTGCCTCAACTTTTTTGAGAAAAATACTCTATTCTTAAGTATCAGTTTTATTCTCATGTACCTAAATTGTGGAGAAAATGATTGCATTCCATAAACTGCCTGCAGACCTTAGCAAGCTCTTCAAAGTAACTCCATAGTACACTGGAGCACCTGCATCCGAGAGCATGCTTACATTTTACTGTTCTGCATATTACAAAAAAATAACTTGCAACTTCAGATAACTTCTTTGACTAAGTAAATTACATTTTTGACTGCAGTTTATATGAAACTATATGGAAGGTTTTTTTATAAACTGCATCGAGATCCAAAAGGCTAAATTGTTTTAAAAGAAATCAATAAAGATTCCTAAAAGAATTACAGTTGTGTTCAAGTTTGATATTTGAAAAAAGGATGAGGGACAATGATATTGAAGGGTCTTGGTTCCAGTGATAATTAAGGTATTAGTTATAGCTGAGCATGAAACTGGAACAATATCATATAAATAGACTTCAGAGATAATTTCGAGATGGTGGATCCTTTCAGGATTTAGAAATTTTGAATATTTATGTGAATAGACTTCTTGTGGTCCCAAAGTTAATGCTATTCAAGAAACAATTTTGTGAGAGCATTACAAAGTTGGTAAGAGGGAAGAATTCTATATGATAAACAGTTCACAGTTTGGGGCTTTTTCTAGACTAAGTTTTTAGGATAGAACAAAATTATTTACTTAAACTCTCCATATGAAATTGTTCTATAGGTGTTTAGAGTATACAACAAATATGGTGCAAATAAATGTATGAAAATTAAGTGTCTTAAAGGTAGAATATACTAAAAGATTTTAAAATATAAAGTTTTCCTAAGATCATAATACAAATTGAAACAGACTTTCTTGAGAATATTTTTTTTAAAAAAATGGAACATACACAGTGGATAGTTTATCAGAGACCCTGCTAATATGTTTAAAAAATTGTAATGATGGGGTAGGAGTTTGAGGAAATAACCGGAGATAAATGTATGTGTTCATAAACAAGTGTCTCGACTAATCATAGTTTCTTATGTTTAGTTCAGTATTTATAAATATGAGGATATTTTGATTTAGATAAGCTATATGTTGGTATATACACCTTTGTGAGGAATAAAATCCCATTTAGGTTTAAATAAAAGCAATCGGTTAATCAATTGATATTCTCTGAGTTAAATTCAGAAGTGTTCAAAATAGGGCTAAAATCATGATATCTGTTCTTTCTGTAGACTACACAGTCAGAATATGAATTTTAACTATATTAAC