Transcript asmbl_13195

Sequence
Transcript Sequence for observation asmbl_13195 of TGE0000123:
TTGGGTATTCTCTATGGTTCCAGGGTCAAGCGGCGCTAAGAGAAGGCGGGACAGAGGAATGGGAAATGACGTGAGGAGTGCGGAGGGGCGCGAGGTTTCAAGATGGCGGTAGCTGAGGGGTTGACCGAGAGACCCAGTTGAAGGCCTTTACGAAGTGAAAGAGGCCGGGAGTCGCCCCCTACCCGCTTCTCGTAGTCCTGGGAGCACAGCAGAAGTGTTTTTCTTTTTTTAATGAACAAGTAAACCATACAAATTGTCAACATGGGACGGAGATCTACATCATCCACCAAGAGTGGAAAATTTATGAACCCCACAGACCAAGCCCGAAAGGAAGCCCGGAAGAGAGAATTAAAGAAGAACAAAAAACAGCGCATGATGGTTCGAGCTGCAGTTTTAAAGATGAAGGATCCAAAACAGATAATCCGAGACATGGAGAAATTGGATGAAATGGAGTTTAACCCAGTGCAACAGCCACAATTAAATGAGAAAGTACTGAAAGACAAGCGTAAAAAGCTGCGTGAAACCTTTGAACGTATTCTACGACTCTATGAAAAAGAGAATCCAGATATTTACAAAGAATTGAGAAAGCTAGAAGTAGAATATGAACAGAAGAGGGCTCAACTTAGCCAATATTTTGATGCTGTCAAGAATGCTCAGCATGTGGAAGTGGAGAGTATTCCTTTGCCAGATATGCCACATGCTCCTTCCAACATTTTGATCCAGGACATTCCACTTCCTGGTGCCCAGCCACCCTCTATCCTAAAGAAAACCTCAGCCTATGGACCTCCAACTCGGGCAGTTTCTATCCTTCCTCTTCTTGGACATGGTGTTCCACGTTTGCCCCCTGGCAGAAAACCTCCTGGCCCTCCCCCTGGTCCACCTCCTCCTCAAGTCGTGCAGATGTATGGCCGTAAAGTGGGTTTTGCCCTAGATCTTCCCCCTCGTAGGCGAGATGAAGACATGTTATATAGTCCTGAACTTGCCCAGCGAGGTCATGATGATGATGTTTCTAGCACCAGTGAAGATGATGGCTATCCTGAGGACATGGATCAAGATAAGCATGATGACAGTACTGATGACAGTGACACCGACAAATCAGATGGAGAAAGTGACGGGGATGAATTTGTGCACCGTGATAATGGTGAGAGAGACAACAATGAAGAAAAGAAGTCAGGTCTGAGTGTACGGTTTGCAGATATGCCTGGAAAATCAAGGAAGAAAAAGAAGAACATGAAGGAACTGACTCCTCTTCAAGCCATGATGCTTCGTATGGCAGGTCAAGAAATCCCTGAGGAGGGACGGGAAGTAGAGGAATTTTCAGAGGACGATGATGAAGATGATTCTGATGACTCTGAAGCAGAAAAGCAATCACAAAAGCAGCATAAAGAGGAATCCCATTCTGATGGCACATCCACTGCTTCTTCACAGCAGCAGGCTCCGCCGCAGTCTGTTCCTCCTTCTCAGATACAAGCACCTCCCATGCCAGGACCACCACCTCTTGGACCACCACCTGCTCCACCATTACGGCCTCCTGGGCCACCTACAGGCCTTCCTCCTGGTCCACCTCCAGGAGCTCCTCCATTCCTGAGACCACCTGGAATGCCAGGACTCCGAGGGCCCTTACCCCGACTTTTACCTCCAGGACCACCACCAGGCCGACCCCCTGGCCCTCCCCCAGGTCCACCTCCAGGTCTGCCTCCTGGTCCCCCTCCTCGTGGACCCCCACCAAGGCTACCTCCCCCTGCACCTCCAGGTATTCCTCCACCTCGTCCTGGCATGATGCGCCCACCTTTGGTGCCTCCCCTTGGACCTGCCCCCCCTGGGCTGTTCCCACCAGCTCCCTTGCCAAACCCTGGGGTTTTAAGTGCCCCACCCAACTTGATTCAGCGACCCAAGGCGGATGATACAAGTGCAGCCACCATTGAGAAGAAAGCCACAGCAACCATCAGTGCCAAGCCACAGATCACTAATCCCAAGGCAGAGATTACTCGATTTGTGCCCACTGCACTGAGAGTACGTCGGGAGAATAAAGGGGCTACTGCTGCTCCCCAAAGAAAGTCAGAGGATGATTCTGCTGTGCCTCTTGCCAAAGCAGCACCCAAATCTGGTCCTTCTGTTCCTGTCTCAGTACAAACTAAGGATGATGTCTATGAGGCTTTCATGAAAGAGATGGAAGGGCTACTGTGACAGCTTTTGATGCCAGAAAAGGCTTCTGTTCACAACAGTGGCCCATGGAGAAAGAGGCTCTTATTAAACTTAGATGAAAGAGCTGCTTCCATTGTCAGGGTATTTTCTAATTTCAGTTCAAGGAATATCCTAAAATTTAGCCTTGTTCAGAATTTACTGCACATAAAAAAGGGTATTTCATCCAGAATAGATCAGTTATTGAAGCAGTGCTGCTAACATCCATTCCCTTTCATACCACCATTTTCACCCTGTTTCTTCCCCTCCTCCAGTTCTTTGGAAATTTGTGATCGGGGGATCTTAGTTGCTTATTTGTTTTGACTCTTGTGTGCTGTGGGCACTGGAGTAGAGATTTCTGGAGAAAAAAAAACAGTTTATTTCATCTTGCCTTTTGTGTTTGAGTTATTTTTAATATTTTCCTGTAAATATTTTGTAATATTTTACTTGTAATGAAATGGATCACAATGTCATTTCCTAATACAAGGCAGGATATGTGGGAAGAATATGTACAATTATTTGATTAAAATTATTTCCCACTGACCTAAACTTTCAGTGATTTGTGGGAAAAATAAATAAATGTTCTACACCAAGATACTCTGTGTTACTGATAATATGTAAACATAATACCTATTTTATGGACAGAAAAAGTTAAATATTTAAAACTTGGGTCTTTAAGGAACTGCCTTTCTGGTACAGAATGAGAATCTTACTGAAAACATGGTAAAAACTACATTTTAAATTTTAA