Transcript asmbl_74831

Sequence
Transcript Sequence for observation asmbl_74831 of TGE0007598:
GTTATTCTATTCTCTTGCTGCTGCTCTTCAGGCGCTTCTTTTCCCTCTCTTCTCTCTTCTCCACGCGAGGGGGTGCGCGTACCCTTAGTCGTGGTCGCGCACTCAGCCCCTGTGCTACTCTCGTGGCACTTTCATCATGGCGGGCATCCTGTTTGAGGATATTTTTGATGTAAAAGACATTGACCCGGAGGGCAAGAAGTTTGACCGAGTGTCTCGACTGCATTGTGAGAGCGAATCTTTCAAGATGGACCTTATCTTAGATGTAAACATTCAGATTTACCCTGTAGACTTGGGTGACAAGTTCCGGTTGGTCATAGCCAGTACCTTGTATGAAGATGGTACCCTGGATGATGGTGAATACAACCCCACAGATGACAGACCTTCCAGGGCTGACCAATTTGAGTATGTAATGTATGGGAAAGTGTACAGGATTGAGGGAGACGAAACTTCTACTGAAGCAGCAACACGTCTCTCTGCCTACGTCTCGTATGGGGGCCTGCTCATGAGGTTGCAGGGTGATGCCAATAACCTGCATGGATTTGAAGTGGATTCCAGAGTTTATCTGCTGATGAAGAAACTGGCCTTCTGAACCACCTGGGAAGCCAATCTTGCTGCTTAGTCACTTAGGTCATGGACATTCATTCAAGTCTGAGCAGCAGTTGCTGTTGTTCACCTGTCTAAGAGGGGCTGGATTTGTGTTGATTGTGCCGTGCATCTTTAGGTGGTGTCTGAACTCAATGGGAAGTTGACTTGCTTGTGAAAGACCCAGTGGGAGGGCTTAAAAGGAATAAGAAGTTGTTGTGTGTATATGATTTTTTAAATTAAACTTTACTTTCTCAGA