Transcript asmbl_7328

Sequence
Transcript Sequence for observation asmbl_7328 of TGE0007464:
CGGCTTCCGGCCTGTCTTAATTCCGCTTCCGGTCAAGCGGAATCGTCTTTGCTGAGGGTCACATTGAGCTGCGAGCTGTTTCAGGGGCGTCTTTAGGAGTCAGCAACATGGCAGAAGACATCAAGACCAAAATCAAGAACTACCAGACTGCCCCTTTTGACAGCCGCTTCCCCAACCAGAACCAGACCAGGAACTGTTGGCAGAACTACCTGGACTTCCACCGCTGTGAGAAGGCAATGACCGCTAAAGGGGGTGATGTCTCCGTATGTGAATGGTACCGGCGTGTGTACAAGTCCCTCTGCCCCATATCCTGGGTGTCAACCTGGGATGACCGCCGGGCAGAAGGCACATTTCCTGGGAAGATCTGAACTGGCTTCACTCCACCTCTCCTCTGTCTTCCATCCCTCTCCCAGGGAAGCGAGGGTGGACCTGGGTACATCCCACCCTGGGATCCTAAATCGTGGTTTAACTAATAATAAATACTTGTTGGAAAAGTATAAGACTATGTGTGAAAGAGCTGGATGATGAGCAAGAAGCTAGGTTGGAAATAGTGCCTAGACCAGTAAGAGGGGCTTCAGAGTGATTATTTTTTTGTTTCATTTTGTTTTTAATTTTTATTTTATCAAACTTTGACCACTTCCTCTGTGCCAGACAGTAGAGTGAGTGATTATATGAAATAGACTCAAGCCCCTATATATGCTAAAATTTATCTGCATGTTCCTTTAATTATTTGTACATTTTTTAACATG