Transcript asmbl_72783

Sequence
Transcript Sequence for observation asmbl_72783 of TGE0007456:
CCCCGCGCAGCGCGGCTGTGTTTGCGTTGCGGCCTGTGCGAGTAGTCGCTTCGGAACCAGTCTCCCGGCGAGCGGCGCGCAGAAACCTCGAACCGGTGGAGCCCACTCGTAACCTGGAGCCCATAAGGCCGCGAAGACAGTACCTTTTCCTTAGCGGCGGACTGCTGCAGTAAGAATGTCTTTCCCCCCTCATTTGAATCGCCCTCCCATGGGAATCCCAGCACTCCCACCAGGGATCCCACCCCCACAGTTTCCTGGCTTTCCTCCACCTGTACCTCCAGGAACCCCAATGATTCCTGTACCAATGAGCATTATGGCTCCTGCTCCAACTGTCTTAGTACCCACTGTGTCCATGGTTGGAAAGCATTTGGGAGCAAGAAAAGATCATCCAGGCCTAAAGACTAAAGAAAATGATGAAAATTGTGGTCCCACTACTACGGTTTTTGTTGGCAACATTTCTGAGAAAGCCTCAGACATGCTTATAAGACAGCTCCTTGCTAAATGTGGCTTGGTTTTAAGCTGGAAGAGAGTACAAGGTGCATCTGGAAAACTTCAAGCCTTCGGATTCTGTGAGTATAAGGAGCCTGAATCTACCCTCCGTGCACTCAGGTTATTGCATGACCTACAGATTGGAGAGAAAAAGCTACTTGTTAAAGTTGATGCAAAGACAAAGGCACAACTGGATGAATGGAAAGCAAAGAAGAAAGCTTCTAATGGGAATGCCAGGCCAGAAACTGTCACTAATGATGATGAAGAAGCCTTAGATGAAGAAACTAAGAGAAGAGATCAAATGATCAAAGGGGCCATTGAAGTTTTAATACGAGAATACTCCAGCGAGCTCAATGCCCCTTCACAAGAATCTGACTCTCATCCCAGGAAGAAGAAAAAGGAAAAGAAGGAGGACATTTTCCGCAGATTTCCGGTGGCACCACTGATCCCTTATCCGCTCATCACTAAGGAGGATATAAATGCTATAGAAATGGAAGAAGACAAAAGAGACCTGATATCCCGAGAAATCAGCAAATTCAGAGACACACACAAGAAACTGGAAGAAGAGAAAGGCAAAAAAGAAAAAGAAAGACAGGAAATTGAGAAAGAACGGAGAGAAAGAGAGAGGGAGCGTGAAAGGGAACGAGAAAGGCGAGAACGGGAACGAGAAAGAAAAACGTGAACGAGAAGGAGAAGGAACGGGAGCGGGAACGAGAACGGGATAGGGATCGTGACCGGACAAAGGAGAGAGATCGAGATCGGGATCGAGAGAGAGATCGGGACCGCGATCGTGAGAGGAGCTCAGATCGAAATAAGGATCGGAGTCGATCTAGAGAAAAGAGCAGAGATCGTGAAAGGGAACGAGAGCGAGAAAGAGAAAGAGAGCGAGAACGAGAACGAGAGAGAGAACGTGAGCGAGAGAGAGAGCGAGAAAGGGAACGAGAGCGTGAGAGAGAGAAAGACAAGAAGAGAGACCGAGAAGAGGATGAAGAAGATGCATATGAACGAAGAAAACTTGAAAGAAAACTTCGAGAGAAAGAAGCTGCTTATCAAGAGCGCCTTAAGAATTGGGAAATTAGAGAACGGAAGAAAACCCGGGAGTATGAGAAAGAGGCTGAAAGAGAAGAAGAAAGAAGAAGAGAAATGGCAAAAGAAGCTAAACGACTAAAAGAATTCTTAGAGGATTATGATGATGATAGAGATGATCCCAAATATTACAGAGGAAGTGCTCTTCAGAAAAGATTGCGTGATAGGGAAAAGGAAATGGAAGCAGATGAACGGGATAGGAAAAGAGAGAAGGAAGAGCTAGAGGAAATCAGGCAGCGCCTTCTGGCAGAAGGGCACCCGGATCCAGATGCAGAGCTCCAGAGGATGGAACAAGAGGCTGAGAGGCGCAGACAACCACAAATAAAGCAAGAACCAGAATCTGAGGAAGAAGAAGAAGAAAAACAAGAAAAAGAGGAAAAACGAGAAGAACCCATGGAAGAGGAAGAAGAGCCAGAGCAGAAACCCTGTCTCAAACCAACTCTGAGGCCCATCAGTTCTGCTCCATCTGTTTCCTCTGCCAGTGGCAATGCAACCCCCAACACTCCTGGGGATGAGTCTCCCTGTGGTATTATTATTCCTCACGAAAATTCGCCAGATCAACAACAACCTGAGGAGCATAGGCCAAAAATAGGACTAAGTCTTAAACTGGGTGCTTCCAATAGTCCTGGTCAGCCTAATTCTGTGAAGAGAAAGAAACTCCCCGTAGATAGTGTCTTTAACAAATTTGAGGATGAAGACAGTGATGATGTACCCCGAAAAAGGAAACTGGTTCCCTTGGATTATGGTGAAGATGATAAAAATGCTGCCAAAGGCACTGTAAACACTGAAGAAAAGCGCAAACATATTAAGAGTCTCATTGAGAAAATCCCCACAGCCAAACCAGAGCTCTTTGCATATCCCCTGGATTGGTCTATTGTGGATTCTATATTGATGGAACGACGAATTAGACCATGGATTAATAAGAAAATTATAGAATACATAGGTGAAGAAGAAGCTACATTAGTTGATTTTGTTTGTTCTAAGGTTATGGCTCATAGTTCACCTCAGAGCATTTTAGATGATGTTGCCATGGTACTTGATGAAGAAGCAGAAGTTTTTATAGTCAAAATGTGGAGATTATTGATATATGAAACAGAAGCCAAGAAAATTGGTCTTGTGAAGTAAAACTCTCTTTACACTTAAGAGTTCCATTTCAGATACCATCTTTCCCATCCTTCAAAGGACTTTGAATTTTTCTTTGTCTTCAAAGACATTTGCAAGATCTGTAATTTTTTTTTAATGTAGAAAATGTGAATTTTTTTTGTCCTCCAATTCGTTGATGCCTTGTGTACTCTCTTGGTTGTAAAGACATCTGAATCCTACTTTGGTTCTCTTTATACTCACCAGGTACAAATTACTGGTATGTTTTATAAGCCGCAGCTACTGTACACAGCCTATCTGATATAATCTTGTTCTGCTGATTTGTTCCTTGTAAATATTAAAATGACTCCCCAATTCTTTTGCAGAATTGCACTTAATATTGAACTGTACTGTAAAGGAACCAACACGAACAATTTTAATTGAAAGAATACCAGTCCTTCCTTCCCTATTTGATCAGAATTGGCAAGCTTTCATGAAGGCATGAAATTAATTTTTGAAATTAGAGTGCGAAAATTAGCAGACCATCCATTCCTACTGTATCTGTATGAATGTGTTTGTGTGAATGTATATATAAAAGTGTTACTTTGCCCTGATTTGCTTTGGAGGGCTCCCGTAAACATTTCCTAACTGAAGAATAGAATCGTAAAGGAAACGTGGTGTTGTGCCAACCCAAATGTCTGGGATAATTAGGTTATTAGTCTCCCAGAGCATGGTATTCTTTTCTGGCAAGCAACAGTCTGTTGAATAGCATGGGGTTCTCCTGTTGATAGCTGGCTGCTTCAGCCTCTCTTTTTAAGGGACTGTGAATCACTGATCCCCTGCCCCTCAATTTCATTGTGCAGAGATGAGTCAGATCCTTAGATTCTGGAGAGCTTTATTTAATGCATTTTTGCACTAATTGGTCTTTAGCTTAATTTTGGTGTACCCCTTTTGTTGGGAAAAAAATGGAAAAGCATAAATGAGGGAAAAAAAACTTGAGAAACAAAAGATAAAATTAGGCCATTTGACAGACTAGGAAAATTTGACAAAATATACTAGGAATTCAGCATGGCATTTTACGTTTACATCTTATTTCTAAGGATAAAGTAAATCATTTAAGGCAGTTACCACTAATTTTTTGTTTTTGTTTTGATAAAGGGTTTATAGCTTGTGCTTGTGTATATACACACACACTTTGTTTACCTCTGCTCATCAAAGTTTGAAAATATACTGATGTTGTTAGAGACATACATTTCTTTATTGTAGATCAGAACTTCACCAGGGAGCAAAATTACCTGAAAACGTAACGAGTTTTAAACAGTTCTTAACAGAGTAGGTGTGGCTATTACCATGTCTGAGTATTTATTTAAAAGAAAAATAAAGATTTGGTGGCGGTGGGGGGATGTTAAAAAGCATAACTGAGCTTGAGTTATTAGATTTTTTTACATCTTAAAGAGGACATTTGAAAACACTGTTCTTAATATTGGACCATGACATGGTTCTATTATGTAAATATTTCAAATATTAAAAATGTATATATTTGATCTTGGGGACTCATTCTTTCAGAGTCTTATTAAATAAATGGCATCATGCTGTAATTGTGCAGTGCATACTAGAAACTTAACTTGAAAATATGGGCTAAATTAATTTTTATGAATATTAGTGACTGAAGGGCAAAGAGGATATTACCTAATTTTAGATTACTCTATATGTCTAT