Transcript asmbl_70805

Sequence
Transcript Sequence for observation asmbl_70805 of TGE0007389:
CTCTCGTAACGGACGAGCGTCTGTGGAGAAGCGGCTTTCTCTCTTATTGTCTCGTGGGCCCCGCTGGTTTAGTTGCTTGCAGGGTTCTCGAGCCCTTTCACGACCGTCACCATGGAGGTGTCACCACTGCAGCCTGTAAATGAAAATATGCAAATCAACAAAACAAAGAAAAATGAAGATGCTAAGAAAAGACTGTCTATTGAAAGAATCTATCAAAAGAAAACACAGTTGGAACACATTTTGCTCCGTCCAGACACTTACATTGGCTCTGTGGAATTAGTGACCCAGCAAATGTGGGTTTACGATGAAGATATTGGCATTAACTATAGGGAAGTCACTTTCGTTCCTGGTTTATACAAAATCTTTGATGAGATTCTAGTCAATGCTGCAGACAACAAACAAAGAGACCCAAAAATGTCTTGTATTAGAGTCACAATTGACCCGGAAAACAATTTAATTAGTATATGGAATAATGGAAAAGGTATTCCTGTTGTTGAACACAAAGTTGAGAAGATGTATGTCCCAGCTCTCATCTTTGGACAGCTCCTAACTTCTAGTAACTATGATGATGATGAAAAGAAAGTAACAGGTGGTCGAAATGGCTATGGAGCCAAATTGTGTAACATATTTAGTACCAAATTTACTGTGGAAACAGCCAGTAGAGAATACAAGAAAATGTTCAAACAGACGTGGATGGATAACATGGGGAGAGCTGGTGAGATGGAACTCAAGCCCTTTAATGGAGAAGATTATACATGTATTACCTTCCAGCCTGATTTGTCTAAGTTTAAAATGCAGAGCCTTGACAAAGATATTGTTGCACTGATGGTTAGAAGAGCATATGATATTGCTGGATCCACTAAAGATGTCAAAGTCTTTCTCAATGGAAATAAGTTGCCAGTGAAAGGATTCCGTAGCTATGTGGATATGTATTTGAAGGATAAAGTAGATGAAACTGGCAATCCATTGAAAATCATCCACGAACAAGTAAACCACAGGTGGGAAGTGTGTTTAACAATGAGTGAAAAAGGCTTTCAGCAAATTAGCTTTGTCAACAGCATTGCTACTTCCAAGGGTGGCAGACATGTTGATTATGTAGCTGATCAGATTGTGACTAAACTTGTTGATGTTGTGAAGAAGAAGAACAAGGGCGGTGTTGCAGTAAAAGCACATCAGGTGAAAAATCACATGTGGATTTTTGTGAATGCCTTAATTGAAAACCCAACCTTTGACTCTCAGACAAAAGAAAACATGACTTTACAAGTCAAGAACTTTGGATCAACATGCCAACTAAGTGAAAAATTCATCAAAGCTGCAATTGGCTGTGGTATTGTAGAAAGCATACTAAACTGGGTGAAGTTTAAGGCTCAAATCCAGTTAAACAAGAAGTGTTCCGCTGTGAAACATAACAGAATCAAGGGTATTCCCAAACTTGATGATGCCAATGATGCAGGGGGCCGAAACTCCACTGAGTGTACACTTATCCTGACCGAGGGAGACTCAGCTAAAACTTTGGCTGTTTCAGGCCTTGGTGTGGTTGGGAGAGATAGATATGGGGTTTTCCCTCTTAGAGGAAAAATACTCAATGTTCGAGAAGCTTCTCATAAACAGATAATGGAAAATGCCGAAATTAACAATATCATCAAGATTGTGGGTCTTCAATACAAGAAAAACTATGAAGATGAAGATTCATTGAAGACTCTTCGTTATGGGAAGATAATGATTATGACAGATCAGGACCAAGACGGTTCCCATATCAAAGGCTTGCTGATTAATTTTATCCATCACAACTGGCCCTCTCTTCTGCGACATCGTTTTCTGGAGGAATTTATCACTCCCATTGTAAAGGTGTCTAAAAACAAGCAAGAAATGGCATTCTATAGTCTGCCTGAATTTGAAGAATGGAAGAGTTCTACACCAAATCATAAAAAATGGAAAGTCAAGTATTACAAAGGTTTGGGCACCAGCACATCAAAAGAAGCTAAAGAATACTTTGCAGATATGAAAAGACATCGTATCCAGTTCAAATATTCTGGTCCTGAAGATGATGCTGCAATCAGCCTGGCCTTTAGCAAAAAACAGATAGATGATCGAAAGGAATGGTTAACTCATTTCATGGAGGATAGAAGACAACGAAAGTTACTTGGCCTTCCTGAGGATTACTTGTATGGGCAAACAACCACATATCTGACCTACAATGACTTCATAAACAAGGAACTAATCCTGTTCTCAAATTCTGATAACGAGAGATCTATCCCGTCTATGGTGGATGGTTTGAAACCAGGTCAGAGAAAGGTTTTGTTTACGTGTTTCAAACGGAATGACAAGCGAGAGGTGAAGGTAGCCCAGTTAGCTGGGTCAGTGGCTGAGATGTCCTCTTATCATCATGGTGAGATGTCACTAATGATGACCATTATCAATTTGGCTCAGAATTTTGTGGGTAGCAATAATCTGAACCTCTTGCAGCCCATTGGTCAGTTTGGTACCAGGCTGCATGGTGGCAAGGATTCTGCTAGTCCTCGATACATCTTCACAATGCTCAGCCCTTTGGCTCGGTTGTTATTTCCACCACAAGATGATCACACATTAAAGTTCTTATATGATGACAACCAGCGTGTGGAGCCTGAGTGGTACATTCCTATTATACCCATGGTGCTGATAAATGGTGCTGAAGGAATTGGTACTGGGTGGTCCTGCAAAATTCCCAACTTTGATATTCGTGAAGTCGTGAATAATATCAGGCTTTTGATGGATGGAGAAGAACCTTTGCCAATGCTTCCCAGTTACAAGAACTTCAAGGGTACTATTGAAGAGCTGGCTCCAAATCAGTATGTGATTAGTGGTGAAGTGGCTATTCTTAATTCCACAACCATTGAAATCTCAGAGCTTCCCATCAGAACATGGACCCAGACATATAAAGAACAGGTTCTGGAACCAATGTTGAACGGCACAGAGAAGACACCTCCTCTTATAACAGATTATAGGGAATACCATACAGATACCACTGTGAAGTTTGTTGTGAAAATGACTGAAGAAAAACTGGCAGAGGCCGAGAGAGTGGGACTACACAAAGTCTTCAAACTCCAAACTAGTCTCACATGCAACTCTATGGTGCTTTTTGACCACGTAGGCTGTTTAAAGAAATATGACACAGCGTTGGATATTCTAAGAGACTTCTTTGAACTCAGGCTTAAATATTATGGATTAAGAAAAGAATGGCTTCTAGGAATGCTTGGCGCTGAATCTGCTAAACTGAACAATCAGGCTCGCTTCATCTTAGAGAAAATAGATGGCAAAATAATCATTGAAAATAAGCCTAAGAAAGAATTGATTAAAGTTTTGATTCAGAGAGGATATGATTCGGATCCTGTGAAAGCTTGGAAAGAAGCCCAGCAAAAGGTTCCAGATGAAGAAGAAAACGAAGAGAGCGATAATGAAAAGGAAACTGAAAAGAGTGACTCTGTAACTGGACCAACCTTCAACTACCTTCTTGATATGCCTCTTTGGTATCTTACCAAGGAAAAGAAAGATGAACTATGCAAATTAAGAAAGGAAAAAGAACAAGAGCTAGAAACATTAAAGAAAAAGAGTCCATCAGATTTGTGGAAAGAAGACTTGGCTGCTTTTATTGAAGAGCTGGAGACTGTTGAAGCCAAGGAAAAACAAGATGAACAAGTAGGACTTCCTGGGAAAGGGGGGAAAGGAAAAGGGAAAAAAACACAAATGGCTGAAGTTTTGCCTTCACCAAGTGGAAAAAGAGTCATTCCCCGAGTTACCATAGAGATGAAAGCAGAGGCAGAAAAGAAAATTAAAAGGAAAATTAAGAATGAAAATTCTGAAGGAACTCCTCAAGAGAATGGTATGGAACCCGAAAGCCTAAAACAAAGATTAGAGAAGAAACTGAAAAAAGAACCAGGTACCAAGACGAAGAAACAAACTACATTGCCATTTAAACCAGTCAAAAAAGGAAAGAAGAGAAACCCCTGGTCTGATTCAGAATCAGATGCGAGCAGTAACGAAAGTGATTTTGATGTCCCTCCACGAGAAATAGAGCCACGGAGAGCAGCAACAAAAACCAAATTCACAGTGGATTTAGATTCAGATGAAGATTTCTCAGATTTTGATCAAGAAACTCAAGATGAAGATTTTGTGCCATCTGATGCTAGTCCAGTTAAGACCAGAACTTCCCCGAAACGTGCTAACAAAGAACTGAAGCCACAGAAGAGCACCACGTCAGTAACGGACTTTGATGCTGATGATGCCAAGGACGATGTTCCACTTTCTCCAAGTTCTCCTGCTGCTGATTTCCCAGCCGAAACAGAAATTGTAAACCCTGTTTCTAAAAAGAACGTGACAGTGAAGAAGACGGCAGCAAAAAGTCAGTCTTCCACCTCGACTACAGGTGCCAAAAAAAGGGCTGCACCAAAAAGAACCAAAAAGGATCCAGGCGTGAATTCTGATGCCCCTCAAAAGCCTGATCCCCCCAAAACCAAGACTCGCCGCAAAAGAAAGCCATCCACTTCTGATGATTCCGACTCTAACTTTGAGAAAATGATTTCTAAAGCAGTCACAAGCAAGAAATCCAAGGGGGAGAGTGATGACTTCCACCTGGACTTAGACTCAGCTGTGGCTCCTCGTGTAAAATCTGGGCGGGCAAAGAAGCCGATAAAGTACCTTGAAGAATCAGATGAAGATGATCTGTTTTAAAATGTGAGGTGACTATTTTTAGTGGTCTTATTGAGCCCAAGACTGGTTTGAATCTCTTAATTTCCTCCCCTTTAAATTTAGTTTGGGGAAAGTAGTTTTGATCTAAAATCACCAAAGTGAAGTATGTAGAGCCCAGCGTCCCTTATCTTTTTATGATACAGTCTAAATGGTGATACATCTCATGGGCATTGTTTTTTTCTCTGCTTTGTCTGTATTTTCATTCTGTTTCCTTTTGTCTTTAAAATCTGATTTTAACTTCTGGACTCCAGAGATAGTTATGTGGTCATTCCAGCATAATGTAGTTTGTTTATTGACCATACATTAAGCTAAAATTGGAGCACTTTGATATAAAAGTGTCTACTGTGCCTCCTTTCTTACCTTCATAAATATGAGATAGAGCATGATTAATTCTGTTTTATCTTAGTTATATAGGTAATTTTCCATCAGATAGAATTTTATAGTTCTAGTACAAATACTCCCCACTCAGCCTTTTATGTGCTGAATTTTTGTTCAAACAATGAGATATTGCTCATATTCTTCATACTCTTTTAGAATGTCAGCAGAGGCTAAAGAAAAACACCTTGGCTGTGTCTGTAGAACCTCAACACAGTCAAGAGGATGAAGAAAATTAGACCATAAGTTATATAAACCAGTGCTGTCTCAACTCTTGACTGTCCCCTCTGGCTGCCTCTGAGTCTGAATTTCCCAAAGAACAAATTTCTGGGGAGCACTAGATTGCAGAAGAGTGGGGACAGCATTCATTCAGAGACCTTAAATATTTTATTGATACCATATTCAGCAATGAGCTTTTATATCCATTTTGAGAAATCTCCATAATTTTCAACTTGTAAACTTTTTAAAGACCTTTCTGCATTTTACACATCTGTGATTTGAATAGTGTTATCAATGTTTTTGTAAATATTTAATATGTTTTTCTATTTAGCTAAATTCCAGCAATTTTGTACTTTAATAAAATGTTC