Transcript asmbl_30509

Sequence
Transcript Sequence for observation asmbl_30509 of TGE0001227:
CGGCGCGCTCGCGCCGGACCGGAAAGCCGGGGAAGTGGCCGAGGAGGGAGGGCTGCGAGCCATGGCGACCAAGACGGCGGGCGTGGGGCGGTGGGAGGTAGTGAAGAAGGGTCGGCGGCCTGGGGTCGGCGCCGGCGCCGGCGGCCGAGGAGGCGGCAGGAACCGCAGGGCGCTCGGGGAAGCAAACGGAGTGTGGAAATACGACCTGACCCCTGCAATCCAGACCACAAGCACCCTTTATGAGCGGGGCTTTGAGAATATCATGAAGCGGCAGAATAAGGAGCAGGTCCCACCCCCTGCTGTGGAACCTAAGAAACCAGGGAACAAGAAGCAGCCAAAGAAGGTGGCAACTCCTCCCAACCAAAACCAGAAGCAGGGCCGCTTCCGCAGCCTGGAGGAAGCACTGAAAGCTCTGGATGTGGCAGACCTGCAGAAGGAACTGGACAAGAGCCAGAGTGTGTTCTCTGGAAACCCATCCATATGGTTGAAGGACCTGGCCAGCTATCTCAACTACAAGCTACAAGCTCCTCTAAGTGAACCCACGCTGAGCCAGCATACTCATGATTATCCCTACAGCCTGGTGAGCCGGGAGCTACGTGGGATCATCCGAGGGCTGCTGGCGAAGGCAGCAGGGTCTCTGGAGCTCTTTTTTGACCACTGTCTGTTCACCATGTTGCAAGAGCTGGATAAGACACCAGGGGAGTCACTACATGGTTACCGCATCTGTATCCAGGCCATCCTGCAAGACAAGCCCAAGATTGCCACGGCAAACCTAGGCAAGTTCCTGGAACTGCTGAGGTCCCACCAGAGCCGACCAGCAAAGTGTCTCACCATCATGTGGGCCCTGGGTCAAGCAGGTTTTGCCAACCTCACCGAGGGACTGAAAGTGTGGCTGGGGATCATGCTGCCTGTGCTGGGCATCAAGTCTCTGTCTCCCTTTGCCATCACATACCTGGATCGGCTGCTCCTGATGCATCCCAACCTTACCAAGGGCTTCGGCATGATTGGCCCCAAGGACTTCTTCCCACTTCTGGACTTTGCCTATATGCCGAACAACTCCCTGACACCCAGCCTGCAGGAGCAGCTGTGTCAGCTCTACCCCCGACTGAAAGTGCTGGCATTTGGAGCAAAGCCGGATTCCACCCTGCATACCTACTTCCCTTCTTTCCTGTCCAGAGCCACCCCTAGCTGTCCCCCTGAGATGAAGAAAGAGCTCCTGAGCAGCCTGACTGAGTGCCTGACGGTGGACCCCCTCAGTGCCAGCGTCTGGAGGCAGCTGTACCCTAAGCACCTGTCACAGTCCAGCCTTCTGCTGGAGCACTTGCTCAGCTCCTGGGAGCAGATTCCCAAGAAGGTACAGAAGTCTTTGCAAGAAACCATTCAGTCCCTCAAGCTTACCAACCAGGAGCTGCTGAGGAAGGGTAGCAGTAACAACCAGGATGTCGTCACCTGTGACATGGCCTGCAAGGGCCTGTTGCAGCAGGTTCAGGGTCCTCGGCTGCCCTGGACGCGGCTCCTCCTGTTGCTGCTGGTCTTCGCTGTAGGCTTCCTGTGCCATGACCTCCGGTCACACAGCTCCTTCCAGGCCTCCCTTACTGGCCGGTTGCTTCGATCATCTGGCTTCTTACCTGCTAGCCAACAAGCGTGTGCCAAGCTCTACTCCTACAGTCTGCAAGGCTACAGCTGGCTGGGGGAGACACTGCCGCTCTGGGGCTCCCACCTGCTCACCGTGGTGCGGCCCAGCTTGCAGCTGGCCTGGGCTCACACCAATGCCACAGTCAGCTTCCTTTCTGCCCACTGTGCCTCTCACCTTGCGTGGTTTGGTGACAGTCTCACCAGTCTCTCTCAGAGGCTACAGATCCAGCTCCCCGATTCCGTGAATCAGCTACTCCGCTATCTGAGAGAGCTGCCCCTGCTTTTCCACCAGAATGTGCTGCTGCCACTGTGGCACCTCTTGCTTGAGGCCCTGGCCTGGGCCCAGGAGCACTGCCATGAGGCATGCAGAGGTGAGGTGACCTGGGACTGCATGAAGACACAGCTCAGTGAGGCTGTCCACTGGACCTGGCTTTGCCTACAGGACATTACAGTGGCTTTCTTGGACTGGGCACTTGCCCTGATATCCCAGCAGTAGGCCCTGCCTTCCTGGCCACTGATTTCTGCATGGGTAGACCATCCAAGACTGCAGCGGGTAGAAGGTGGCAGTTCTTCATGGGAGTCTTTTTAACTTGGTGCCTGAGTTCTCTCCTAGGCAAGTGGCCAGTTGCCTCCACCTCAGTTCTTCCATCTTTGGTGGGGACAGGGCCCAGCAGCATCTCAGCCTCCTACCCACAATTCCACTGAACACTTTTCTGGCCCTACTGCACATGGCCCCCAGCCTCCATCCTTGTGCTGGTAGCCTCTCACAACTCCGCCCTTGCCCTCTGCCTTCCACTTCCTTCCATCTCATTTCTAAACCCCAAACAGCTCATCTCTAAAAAGATAGAACTCCCAGCAGGTGGCTTCTGTGTTCTTCTGACAAATGATTCCTGCTTCTCCAGACTTTAGCAGCCTCCTGTTCCCATTCTTGGTCACAGCTCTAGCCACAGCAGAAGGAAAGGGGCTTCCAGAAGAATATAGCACCGCATTGGGAAACAGCAGCCTCACCTCCACCTGAAGCCTGGGTGTGGCTGTCAGTGGACATGGGGAGCTGGATGGAAATGCCTCTCACTTCAAAATGCCCAGCCTGCCCCAAATGCCTCTAAGCCCCTCCCTGTCCCCTCCCTTGTAGTCCTACTTCTTCCAACTTTCCATTCCCCATCATGCTGGGGGTCTTGGTCACAAGGCTCAGCTTCTCTCCACTGTCCATCCCTCCTATCATCTGTAGAGCAGAGCACAGGCAGTTGTGTGCCTTGGGCCCAGGGAACCCTCCATCAACCTGAGACAGGACTCAGTATATGGTTCTTGGGTATGCCCTACCAGGTGGAATAAAGGACACAGATTTGATTTCTAGCATTCTTGTCTGCA