Transcript asmbl_70671

Sequence
Transcript Sequence for observation asmbl_70671 of TGE0007360:
AGCAGCAGCAGCAGCAGCCGCCGCACCACCACCACCATTATTATTACTACAACCACAGCCACAACCACCATCACCACCACCATCACCAGCAGCCTCACCAATACCTGCAGCATGGAGCCGAGGGCAGCCCCAAGGCCCAGCCAAAGCCGCTGAAACATGAGCAGAAACACGCCCTCCAGCAGCACCAGGAAACGCCGAAGAAGAAAACAGGCTATGGTGAACTAAATGGTAATGCTGGAGAAAGAGAAGTATCTTTAAAGAACCTGGGTTCTGATGAAGCTACCAGCCCAATTTCCAGGGTCCTCAATGGCAACCAACAAGTTGTAGACACTAATCCGAAGCAGACTGTAAAGACCAGCACCTTTGGGAAAGCAGGAATTAAAACCAGGAATTTCATTCAGAAGAACAGTATGGACAAAAAGAATGGAAAGTCTTATGAAAATAAATCTGGAGAGAACCAGTCTGTAGATAAGAGTGATGCTGTAGCAATTCCAAATGGTGTTGTAACAAATAATTCTGGCTATATTACTAATGGTTATATGGGCAAAGGAGCAGATAATGATGGTAGTGGATCTGAGAGCGGATATACCACTCCTAAAAAAAGGAAAGCTAGGCGCAATAGTGCCAAGGGTTGTGAAAACCTTAATTTAGTGCAGGACAAAATAATGCAACAAGAGACCAGTGTCCCAACCTTAAAACAGGGACTTGAAACTTTCAAGCCTGACTATAGTGAACAAAAGGGAAATCGAGTAGATGGTTCAAAGCCCATTTGGAAGTATGAAACTGGGCCTGGAGGAACAAGTCGAGGAAAACCTTCTGTGGGTGATATGCTGCGGAAAAGTTCTGATATTAAACCTGGCGTGAGCAGCAAAAAATTTGATGACCGGCCCAAAGGAAAGCATGCTTCTGCTGTTGCCTCCAAAGAGGACTCATGGACCCTATTTAAACCACCTCCAGTTTTTCCAGTAGACAATAGCAGTGCTAAAATAGTTCCTAAAATAAGTTATGCAAGCAAAGTTAAGGAAAACCTCAACAAAACTGTACAGAACTCTTCTGTGTCACCATCTTCATCTTCATCCTCTTCATCATCTGTTGGGGAAACTCAGACCCAATCTTCAAGTCGGTTATCCCAGGTCCCTATGTCAGCGCTGAAATCTGTTACTTCAGCCAGCTTTTCTAATGGACCTGTTTTAGCAGGGACTGATGCAAGTGTGTATTCTCCAGGGGGTCAGCCACTGCTAACTACTGCTGCTAATACGCTAACACCCACCTCTTCTGGGACTGATTCAGTTCTCCAGGACATGAGTCTGACTTCAGCAGCTGTTGAACAAATTAAGTCTAGCCTTTTTATCTACCCTTCAAATATGCAAGCTGTGCTGTTGAGCACAGCACAAGTGGATCTACCCTCTCAGACAGATCAGCAAAACCTGGGGGATATCTTCCAGAATCAGTGGGGTTTATCATTTATAAATGAACCCAGTGCTGGCCCTGAGACTGTTACTGGGAAGTCATCAGATAAAGTGATGGAGGTGACATTTCAAGGGGAATATCCTGCCACTTTGGTTTCACAGGGTGCTGAAATAATCCCCTCAGGAACTGAGCATCCTGTGTTTCCCAAGGCATATGAGCTGGAAAAACGGACTAGTCCTCAAGTTCTGGGTAGCATTCTAAAATCTGGGACTACTAGTGAGAGTGGAGCCTTATCCTTGGAACCCAGTCATATAGGTGACCTGCAAAAAGCAGACACCAGTAGTCAAGGTGCTTTAGTGTTTCTCTCAAAGGACTACGAGATAGAAAATCAAAATCCTCTGGCATCTCCTACGAACACTTTGTTAGGCTCCGCCAAAGAACAGAGATACCAGAGAGGCCTAGAAAGGGATGATAGCTGGGGTTCTTTTGACCTGAGGGCTGCTATTGTATATCACACTAAAGAAATGGAATCTGTTTGGAATTTGCAGAAGCAAGATCCCAAAAGGATAATCACTTACAATGAAGCCATGGATAGTCCAGATCAATGAAGGACCAGACTGCCTATTTGTAACCTTCCTGCAGCATTAGAGCCACCGTTCATGGGGGACACAAGGCTTTTATGCTCCTAGATCTTCAACGCAGCAGAGGAACCATAAGTAGAATCACAGGATAATATATACATATATATATATACAT