Transcript asmbl_70379

Sequence
Transcript Sequence for observation asmbl_70379 of TGE0010933:
GCCGCGTCCCCGCCCCGGTGCAGCCCCTCCTCCCCGCTGTGTTTATTAGGGGAAGGAGGGCGGAGGCGGAGGCCAGTTCCCTAGCTCCAGCCGCCGTCGCCAACGCCTGTGTAGTTGCAGCCGCGGCCGTCTCCCGCCAGCTCGCTCCGGGTTAAGAGAACGCGCGCAAGCTCGGGCGTCCCCGCCCCAGCCTTTCCCGGAGCCATGAATCCCAACTGCGCCCGGTGCGGCAAGATCGTGTACCCCACGGAGAAGGTGAACTGTCTGGACAAGTTCTGGCATAAAGCATGCTTCCATTGCGAGACCTGTAAGATGACACTCAACATGAAGAACTACAAGGGCTATGAGAAGAAACCCTACTGTAACGCACACTACCCCAAGCAGTCCTTTACCATGGTGGCCGACACCCCGGAAAACCTCCGCCTCAAGCAACAGAGCGAGCTCCAGAGTCAGGTGCGCTACAAGGAGGAGTTTGAGAAGAACAAGGGCAAAGGCTTCAGCGTCGTGGCAGACACCCCTGAACTCCAGAGAATCAAGAAGACCCAGGACCAGATCAGTAATATAAAATACCATGAGGAGTTTGAGAAGAGCCGCATGGGCCCCAGCGGGGGTGAGGGCATGGAGCCTGAGCGCCGAGATTCCCAGGACAGCAGCAGTTACCGGCGGCCCCAGGAGCAGCAGCAGCCTCACCACATCCCGACCAGTGCCCCAGAAGCGGTACCGTGCCGTCTATG