Transcript asmbl_69775

Sequence
Transcript Sequence for observation asmbl_69775 of TGE0007233:
GCGGGGGCGAGGTTCGGGCCGGTTGTGCCGTTGCGAGACTGCAGCTGCGATCGCTGCGGTGGGCCCAGAATTGTATCCTGACCGTAAATCGGAGAAGCCAGCAGCACTGCCAGTGTTCCTTTGAGGTAGTGTCTGGGATCCGGTGCAAGTTGAATCATTGTTCAAATAAGGTGTAATTGAAAAGTGACTGACCCTCTCTTCAGAGATGTCAAAAACAAACAAATCCAAGTCTGGATCTCGTTCTTCTCGCTCGAGGTCTGCATCAAGATCTCGTTCTCGTTCATTTTCGAAGTCTCGATCTCGAAGTCGATCTGTCTCTCGTTCAAGGAAGCGCAGGCTGAGTTCTAGGTCTCGTTCCAGATCATATTCTCCAGCTCATAACAGAGAGAGGAATCATCCAAGAGTATATCAGAATCGGGATTTCCGAGGGCACAACAGAGGTTATAGAAGGCCTTATTATTTCCGTGGGCGCAACAGAGGCTTTTATCCGTGGGGCCAGTATAACCGAGGAGGTTATGGAAACTACCGCTCAAATTGGCAGAATTACCGGCAAGCATACAGTCCTCGTCGGGGCCGTTCCCGATCCCGGTCCCCAAAGAGAAGGTCCCCTTCGCCACGGTCCAGGAGCCATTCTAGAAACTCCGATAAGTCTTCTTCTGACAGGTCAAGGCGCTCCTCATCCTCTCGTTCTTCCTCCAACCACAGCCGAGTTGAATCTTCTAAGCGCAAATCTGCAAAGGAGAAAAAGTCCTCTTCCAAGGATAGCCGGCCGTCTCAGGCTGCTGGGGAAAACCAGGGAGATGAAGCCAAGGAGCAGACGTTCTCTGGAGGCACTTCTCAAGATTCGAAAGCATCTGAAAGCTCTAAGCCATGGGCAGATGCCAGCACATACAGTGCTGGTTCTGCATCACGGGCCTCGGCAGTTTCCGAGCTGAGTCCCCGGGAGCGAAGCCCTGCTCTGAAAAGCCCCCTCCAGTCTGTGGTGGTGAGACGGCGGTCTCCCCGTCCCAGCCCTGTGCCCAAACCTAGCCCTCCACTTTCCAGCACATCCCAGATGGGTTCAGCTCTGCAGAGTGGTTCTGGGTACCAGGCTGGGACACACCAAGGTCAATTTGACCATGGCTCTGGGTCCTTGAGTCCATCCAAAAAGAGCCCTGTGGGTAAGAGTCCACCAGCCACTGGCTCCACATATGGCTCGTCTCAGAAAGAGGAGGCCGCTGCTCCAGGAGGAGCAGCCTATACAAAGAGGTATCTAGATGAACAGAAGACAGAGAATGGAAAAGATAAGGAACAGAAACAAACAAATACTGATAAAGAGAAAATGAAAGAGAAAGGGAGCTTCTCTGACACAGGCTTGGGTGATTCGAAAATGAAATCTGATCTGTTTGCTCCCAAAACTGATTCTGAGAAGCCTTTTCGGGGTAGCCAGTCTCCCAAAAGATATAAGCTCCGAGATGACTTTGAGAAGAAGATGGCTGACTTCCATAAGGAGGAGATGGATGATCAAGACAAGGACAAAGCTAAAGGAAGGAAGGAATCTGAGTTTGATGATGAACCCAAATTTATGTCGAAAGTCATCGCAGGTGCAAACAAAAACCAGGAGGAGGAGAAGTCAGGCAAATGGGAGGGCCTGGTATATGCACCCCCAGGGAAGGAAAAGCAGAGGAAAACGGAGGAGCTGGAGGAGGAGTCTTTCTCAGAGAGATCCAAAAAGGAAGATCGGGGAGGGCCCAAGAGAACCGAAAGTGGGCACAGGGGGTTTGTGCCTGAAAAGAATTTCCGAGTGACCGCTTACAAAGCAGCCCAGGAGAAAAGTTCATCTCCTCCCCCAAGAAAGACCTCGGAGAGCCGAGAGAAGCTGGGAGCCAAAGGAGACTTTTCCACAGGGAAGTCATCCTTTTCCATTACTCGAGAGGCCCAGGTCAATGTCCGGATGGATTCTTTTGATGAAGACCTTGCAAGACCCAGTGGGTTATTGGCCCAGGAACGCAAGCTTTGTCGGGATCTAGTCCATAGTAACAAAAAGGAACAGGAATTTCGTTCCATTTTCCAGCACATACAGTCAGCTCAGTCTCAGCGGAGCCCCTCAGAACTCTTTGCCCAGCACATAGTGACCATTGTTCACCATGTAAAAGAGCATCACTTTGGGTCCTCAGGAATGACATTGCATGAACGCTTTACTAAATACCTAAAGAGAGGAACTGAGCAGGAGGCAGCTAAAAACAAGAAAAGCCCAGAGATACACAGGAGGATAGACATTTCCCCCAGTACATTCAGAAAACATGGTTTGGCTCATGATGAAATGAAAAGCCCTCGGGAACCTGGCTACAAGGATGGGCATAATTCTAAAAATGAACTACAAAGGGTTAATTTTTATTAAATGTATCAACAACCTTTGTGAAGTGGTTAGAATATGGTAAATGACCCCAAAGTCTATTGAGGTGAGCTTGAGAAAAAAAAGAGAGGAGTTTTGGAACAAGTGCCCATGATGAGAGAAGAAACTTTTTGTGATATTTTTCTGCTTGCTGAGGGAAAATACAAAGATGATCCTGTTGATCTCCGCCTTGATATTGAACGGCGTAAAAAACATAAGGAGAGAGATCTTAAACGAGGCAAATCAAGAGAATCGGTGGATTCCAGAGACTCAAGCCACTCGAGGGAAAGATCAGCTGAGAAAACCGAGAAACCCCATAAAGGATCAAAGAAGCAGAAGAAGCACCGGAGAGCACGAGACCGGTCCAGGTCATCATCCTCTTCCTCCCAGTCATCCCACTCCTACAAAGCGGAGGAGTACACTGAAGAGACGGAGGAGAGAGAGGAGAGCACCACGGGCTTTGACAAATCGAGACTGGGGACCAAAGACTTCGTGGGTCCAAGTGAAAGAGGCAGAGCTCGAGGGGCCTTTCAATTTCGAGCCAGAGGGAGAGGCTGGGGCAGAGGCAACTACTCTGGCAACAACAACAGCAGCAGCAACAATGATTTTCAAAAGAGAAACCGGGAGGAGGAATGGGACCCTGAGTACACACCGAAAAGCAAGAAGTATTACCTGCATGACGACCGGGAAGGAGAAGGCAGTGAGAAGTGGGTGAGCCGGGGCCGTGGCCGAGGAGCCTTTCCCCGAGGTCGAGGCCGGTTCATGTTCCGGAAATCCAGCACCAGCCCTAAATGGGCCCATGACAAGTTCAGTGGGGAAGAAGGCGAGATTGAAGATGACGAGAGTGGGACAGAGAACCGAGAAGAGAAGG