Transcript asmbl_68836

Sequence
Transcript Sequence for observation asmbl_68836 of TGE0007215:
CGGGCCCGCGATTAGGTCATGGCGCTGGCCGCTCGACTCTGGCGCTTTCTCCCTTCGGGACGCGGCACTGCCGTGGGAACTCGGTTTCTGACGGGTGCTGCTGGCAGCCGCGGGACTTGCGGGCCTGGGCGACTCGGCGGCTCTGAGGTGATGGGAAACCCAGGAGCCTTTAAAAGAAGCCTCATATTCTCAGCCTTGTCTTATTTGGGTTTTGAGACTTATCAAGTCATCTCTCGGACTGCTGTGGTTCATGCCACAGCCAAAGTCTTGGGAGTTGAAGAAGTCCTTGCACAAGCAGACTACCTCTACGAAAGTGGAGAAACAGAAAAACTTTATCAGCTGCTGACCCAGTACAAGGACAGCGAAGATGCAGAGTTACTGTGGCGTTTGGCACGGGTGTCACGGGACGTAGCTCAGCTTAGCAGAACCTCGGAAGCGGAGAGAAAGCTGCTGGTGTACGAAGCCTTAGAGTACGCAAAAAGAGCTCTAGAAAAAAACGAAGCAAGCTTTGCAGCTCATAAGTGGTATGCCATCTGTATTAGCGACGTTGGAGATTACGAAGGCATCAAGGCTAAGATTGCAAACGCCTACGTTATCAAGGAGCATTTTGAGAAAGCAATCGAACTGAACCCTAAAGATGCTACTTCAATTCACCTAATGGGCATTTGGTGTTACACGTTTGCGGAAATGCCTTGGTATCAGAGGAGAATTGCTAGAATGCTGTTTGCAGCCCCGCCCAGCTCCACCTACGAGGAGGCCTTGGGCTACTTCCAAAGAGCAGAGCAAGTGGATCCGAACTTCTACAGCAAAAACTTGCTTCTCCTGGGAAAGACGTACTTGAAGCTGCACAACAGAAAGCTCGCTGCGTTCTGGCTGGTGAAAGCCAGGGACTACCCCGCACACACCGAGGAGGACAGGCAGATTCAGATGGAAGCCGCTCAGTTGCTTACAAGTTTCAGTGACAAGAATTGAGAATTTTTCAGAGAAGAAAACACATGAAATACCTAGGAACCACCACCTTTTCATCAAATTACAAGTACATTATAACTGTTCTCTGTCTGTTTTCTTGGTTCTTTTAATGTATTTCACAAATCACAAAAGAAATAATTGCCGTGAGCGTGGTCGGGCTGTCTCTGGCTCAGAGACTACTGTGCATTGGGGGCCCCAGCAGTGCAAAGTGGGATCAGATTTGAGGACTGGTCCCATCAGGCTGGGAGGGGATCAGGAAAAGCTTTGTGGGGGAGGTGGCAGTGGGGACTGCATTGCAAGCTGGATGGAGT