Transcript asmbl_68405

Sequence
Transcript Sequence for observation asmbl_68405 of TGE0007193:
AGCTCAAGAGATGGCTGCCCAGTGTGTGACAAAGGTGGAGCTGAATATTTCCTGCGACAATCTTCTGGATAAAGACATAGGGTCCAAGTCGGACCCGTTATGCGTGTTATTTTTGAATACGAGCGGCCAGCAGTGGTATGAGGTTGAGCGCACAGAAAAGGTCAAGAATTGCTTGAATCCCACATTTTCCAAGACTTTCATTATTGATTACTACTTCGAAGTGGTTCAGAAATTGAAATTTGGGATTTATGACATCGACAACAAGACTATAGAGCTGGGCGATGATGACTTCTTAGGAGAATGTGAATGCACCCTTGGACAAATTGTTTCCAGTAAGAAGCTGACCCGACCCCTGGTGCTTAAGAATGGCAGACCTGCGGGGAAAGGCAGCATCACGATTTCGGCTGAAGAGATAAAGGATAACAGAGTCGTCTTGTTTGAAATGGAAGCCAGGAAACTGGATAATAAGGATCTCTTTGGGAAGTCAGATCCGTACCTGGAATTCCACAAGCAGACATCTGATGGCAACTGGCTCATGGTTCACCGGACAGAGGTTATTAAAAACAACTTGAATCCTGTTTGGAGGCCTTTTAAAATCTCCCTTAACTCCCTGTGCTATGGAGATATGGATAAGATTATCAAGGTAGAGTGCTATGACTACGATAACGATGGGTCACATGATCTCATTGGAACATTCCAAACCACCATGACGAAACTGAAAGAGGCCTCCAGGAGCTCGCCTGTTGAATTTGAATGCATAAATGAAAAGAAGAGACAGAAGAAGAAAAGCTACAAGAATTCCGGTGTCATCAGTGTGAAGCAGTGTGAGATTACAGTGGAATGCACATTCCTTGACTATATCATGGGAGGCTGTCAGCTGAATTTTACTGTGGGGGTGGACTTCACTGGCTCCAACGGTGACCCACGGTCTCCTGACTCCCTTCATTACATCAGCCCCAACGGCGTGAATGAGTACTTGACCGCCATCTGGTCTGTGGGGCTGGTCATTCAGGATTACGATGCTGATAAGATGTTTCCAGCCTTTGGGTTCGGAGCTCAGATTCCTCCTCAGTGGCAGGTGTCGCACGAATTCCCCATGAGCTTTAACCCGTCCAACCCCTACTGTAATGGAATCCAAGGCATTGTGGAGGCATATCGGGCCTGTCTTCCTCAGATAAAACTCTATGGACCAACAAATTTTTCTCCCATCATCAATCACGTGGCCAGGTTTGCTGCCGCAGCCACACAGCAGCAGACAGCTTCTCAATACTTCGTGCTGCTCATCATCACCGACGGTGTGATCACGGACCTGGACGAGACCAGACAGGCGATCGTCAGCGCCGCCAAGCTGCCCATGTCCATCATCATCGTTGGCGTCGGCGGCGCTGACTTCAGCGCCATGGAGTTTCTGGACGGTGACGGTGGGGGCCTGCGCTCCCCGTCAGGGGAGACTGCCATCAGGGACATCGTGCAGTTCGTGCCTTTCAGGCAGTTCCAGAATGCTCCCCGAGAAGCGCTGGCTCAGTGCGTCCTGGCGGAGGTCCCCCAGCAGGTGGTGGGCTACTTCAATACCTGCAAGCTCCTGCCCCCCAAGAACCGCACCGCCCAGTGAAAACGCTCCTGCGCCGCACTGCGGGCTGCCCGTTTCCCACGCTCCCCAGCATCCGTGACGGAAACCGAGTCCCCGTGGACTGCGTCTCCTTAAAGCATTCTTTTATACTTTTCTTGGAAGAAAGTGCTAACTTAACCTTTGTCCAATCAATTCAGTGATTGCTAGTGATTAGAGACTCGCACGAGGAAAGCCGCCTTTGCCATGGTGATTGTTTGCTCTCACAGGATGAAGATGCTGGTTGGAACATTCGTCAGTAGAGAGGATGAAGACTTGTTGGGGGTGGGGGAATTTCAGGCCGCTGTGCTTCGTCGGCTCGAGGCCACATGTGCTACAAGTCAGTGTCCGTCCCCGGTGACGGGCGCTTCTCAAAGCAGACGTGCTGAACCTGTCCCTGCAGTTGCTGAGTGCCTGACCCTTGCCCAAGTCTCGCTGCGGCTTAGCCACAGCACAGCTCGCCCCAGCAGCACCCCAAGACTCTCCGAAGAGCGCAGACGAGGACAGGCACCCTTGCACTTCTCAAAAGGAAGAGGAGCCTCAGGAACGTGCGCGGCTGTTCCCGTGTGCCTTTCCAGGACCCGTGTCTGCACGGAGGGCAGGCCGACCGGGCTCAGCGTCAGTAGCGTTTTTTAATTGGAGTTTGTCAGAATGGTTACGACTGCCTAGTCCAGGAAAGCTACGAGGACCAGACGTGTAGAGAAAACTGAGAATCCCTTCCCTTTTAGCCAATGAAGACTTTACTTACTAAGAAAGGACAATTTTTATCCTTGCTGAGGTCCTATACATTGATTAGTACATTTCTTCACATTCGTGTAGACATTTTTTCCTGTTTTCTTTAGTTACTCTTTTAGTCTGGTTTTTAAACTCATGATAGTGGTTGTCTATTAATCAAAATCATATTTTGCATTTTAATAATGTGCTATTTCCTAAGCCCAGAATGTACTGTATTAAGCCTAAAACCTGTTGCAACTTAAAAAAAATAGCCAACATGCTCTAAGAGCAGAATTCCCCCTTTCAGAATACATTACTCAGCAAACGCTGTCAGAACAGTCAGTAATGTTTTATTGAGGACCTGTGTGCCAGGTACCACGCATACCCACATGTTGGCCAATTATCTTGGATAATTTGACATGAAAATTTGCATGTTTGTCATGTACCCTCAAGGGGACACGCCCAGTGCCATGCCAGCATGCCTTTCGCTCTTTCTGAAACTGCGCCACGGCTCTGGTCTCTTGTTCTCTGAGATGTCTGAAGGACGCGTGAGCCTCGGCCAGGCTCCGTCTGAGAGGGGAGCTGCCTGCTGTCGTGGTCACCCAGCCAGGCGGGCAGTCACCGCCTTCCCGCTCAGTCCGCTGGTCCCTGGCTGCGCGCTGCTGACCTGAAGGCGCCTGACTGGCCGTCTGTACTCCAGGGAGCGGCTCCTTGGCCGGCAAGCCCTTCTGCTGTCAGTTAGGGGAGGGGACTGACGTCCCGCCCAAAGGCTGGGGCCTGCGCTGTCTCAAGTCCTGGTTTGGGTCCTGCGCCTGGGAACAGCACGTGCGTGCCGCTGTTTCAGAAGTTCCTTCTGCAAACACGCGAAGCCTTCTAGAAAAGGTTCCCACACGTTCCCCACGCCTGGTGAGACGCTCAGGAGCAGAGCCCTCGGTTGGGGTCGGCCGGGCTGCACGCCACTCCCCGGGCCTCCTCGTCACCCCCTCACCGCTCCTCATGCTCCTCACAGCTGTGGCCTCTGCAGGGCACTGGGGACCGCTGTCGTGGGTGCTCACTGAGGTCACTGGCCAAGCACGGTACTCTGTCACCACCATCAAATTGATTTGGTCTTCATAGTTACATCATCTGTTTTAACCAAAATTGTTCCCTTTTAAAATTAGTTTTTTGTTATTCATTCTTGATCGGGTTCATCAGTAGATGCTGTTATTCATAAGAACTGTGATTCCAGCAAATTAAGGTAATTGATACCTTTTTGCAGTTTTGAATAAACGCATTTACAATTTCTAAATAATATAAAATTCATACGATTTCGACGTTTCACCTCATTGCCTGCTGATTTAATATTGTTTTATATTAAAAGTCATTTTCCCTGTTGTGCCACCGTTCATTCAAGTGCCATTAGTTCTTAAAATGCCTTTACAGAAAACACAAGCAGTTTGCCTTCCACACCTCCCAGCATGAGACACACTGCGAACGCGTTTGGCCTGACAGCGCCCCGGGCAGAGGCACGGCTTCTCCCCTGCCCGCTGCTAGACGGTGCGCCAGCTAGCACGGCCGCGCCATCGAGCGCTTGGGACCGAAATGGTTACGGTCCCAGGTTTAGTCTCAGGGTGACACTTGTGCCCTGTGCCGTTTCTCCGCAGACTTCCCAGAGCAGATTCAGGGCCCAGTGCTGCTGACGCTTCATTCCACGCGCTGTGCCCTTTTCATTTTGTAAACTTCCCGGAAAGCCACCTTCAGTAGACGCCTCCTAATCTACGTGTGCCATCGACGGTCATGGAAGTGACACATAAGCGAGAAGTTTGGCGTTAATTGCGAGAAACTATTTTGTGCTTTTTGGATGTCATACTCGACAGTGTACAAGTTACAAATACATGAATTGATGTTGAATATATCTCCCATTTGAGATCCCTTTGGATAAAGTTATTTCTTGATGTGACACACAAGAGTGCCTTGTTCTCATTTTTTTCTCTGGTATCAAAACCAGTAGAAAAGTTAGAAATAAAGTGAATGTAG