Transcript asmbl_28753

Sequence
Transcript Sequence for observation asmbl_28753 of TGE0001204:
CCTCCTTCTGTTGCTTCCCGTCTCCTCGGCGGCTCCCCTCCCCCGCCCGGCTCTCCGCGCCCCTTCTGGGCGGCGGGGCGGCGGAGCCGTCGGCGTGCGGCCCTCCTTGCGTTCGTGCGTGCGCCCGTGGCCCGGCGCACGTCCCGCGACACCGAGGCCGAGCGGGGCAGGGGGCTGACCGCCATGACCCCCCAGAGCCCGGCGTGAGGGGGCCGAGATGCGGTGACCTGCCAGCACCTGCCGCAGCCTTCGTCCGGGAGTCGCCCCATCTCTCCACGCATCGGGGCCCTGTGCCCCTTGCTGCTGCAGCCGGGCACCATGTCGACCTCGTCCTTGAGGCGCCAGATGAAGAACATCGTCCACAACTACTCAGAGGCGGAGATCAAGGTTCGAGAGGCCACGAGCAATGACCCCTGGGGCCCATCCAGCTCCCTCATGTCAGAGATTGCCGACCTCACCTACAACGTTGTCGCCTTCTCGGAGATCATGAGCATGATCTGGAAGCGGCTCAATGACCATGGCAAGAACTGGCGTCACGTTTACAAGGCCATGACGCTGATGGAGTACCTCATCAAGACCGGCTCGGAGCGCGTGTCGCAGCAGTGCAAGGAGAACATGTACGCCGTGCAGACGCTGAAGGACTTCCAGTACGTGGACCGCGACGGCAAGGACCAGGGCGTGAACGTGCGTGAGAAAGCTAAGCAGCTGGTGGCCCTGCTGCGCGACGAGGACCGGCTGCGGGAAGAGCGGGCGCACGCGCTCAAGACCAAGGAAAAGCTGGCACAGACCGCCACGGCCTCATCAGCAGCTGTGGGCTCAGGCCCCCCTCCCGAGGCGGAGCAGGCGTGGCCGCAGAGCAGCGGGGAGGAGGAGCTGCAGCTCCAGCTGGCCCTGGCCATGAGCAAGGAGGAGGCCGACCAGCCCCCGTCCTGCGGCCCCGAGGACGACGCCCAGCTCCAGCTGGCCCTTAGTTTGAGCCGAGAAGAGCATGATAAGGAGGAGCGGATCCGTCGCGGGGATGACCTGCGGCTGCAGATGGCAATCGAGGAGAGCAAGAGGGAGACTGGGGGCAAGGAGGAGTCGTCCCTCATGGACCTTGCTGACGTCTTCACGGCCCCAGCTCCTGCCCCGACCACAGACCCCTGGGGGGGCCCAGCACCCATGGCTGCTGCCGTCCCCACGGCTGCCCCCACCTCGGACCCCTGGGGCGGCCCCCCTGTCCCTCCAGCTGCTGATCCCTGGGGAGGTCCAGCCCCCACGCCGGCCTCTGGGGACCCCTGGAGGCCTGCTGCCCCTGCAGGACCCTCAGTTGACCCTTGGGGTGGGACCCCAGCCCCTGCAGCTGGGGAGGGGCCCACGCCTGATCCATGGGGAAGTTCCGATGGTGGGGTCCCGGTCAGTGGGCCCTCAGCCTCCGATCCCTGGACACCGGCCCCGGCCTTCTCAGATCCCTGGGGAGGGTCACCTGCCAAGCCCAGCACCAATGGCACAACAGCAGCCGGGGGATTCGACACGGAGCCCGACGAGTTCTCTGACTTTGACCGACTCCGCACGGCACTGCCGACCTCCGGGAGCAGCGCAGGAGAGCTGGAGCTGCTGGCAGGAGAGGTGCCGGCCCGAAGCCCTGGGGCGTTTGACATGAGTGGGGTCAGGGGATCTCTGGCTGAGGCTGTGGGCAGCCCCCCACCTGCAGCCACACCAACTCCCACGCCCCCCACCCGGAAGACGCCGGAGTCATTCCTGGGGCCCAATGCAGCCCTCGTCGACCTGGACTCGCTGGTGAGCCGGCCGGGCCCCACGCCGCCTGGAGCCAAGGCCTCCAACCCCTTCCTGCCAGGCGGAGGCCCAGCCACTGGCCCTTCCGTCACCAACCCCTTCCAGCCCGCGCCTCCCGCGACGCTCACCCTGAACCAGCTCCGTCTCAGTCCTGTGCCTCCCGTCCCTGGAGCGCCACCCACGTACATCTCTCCCCTTGGCGGGGGCCCTGGCCTGCCCCCCATGATGCCCCCGGGCCCCCCGGCCCCCAACACTAATCCCTTCCTCCTATAATCCAGGGCGGAAGGGGGCCTGGCTCCATCCGGCTGCCCCATTCCGGCTCCCTGGGAGATCAGTGTTGTGAGTGCATGTGAAATGGGGGATCCCCACCCCCAGTGCCCTTCCCCTTCCTGGGGCCCACTCACACTACACCCTCTTCCTTTCCCACCCCACCTCCCCGGAGAGAAACTGGACATGGGGCCTGGGGAGGGGAGCTGGCCAGAGGAGGACCCCTTTCCCGTGGCATTAGAAGGGGGAGGGGTGGCTGGGGCCCCCACCCATTCCCCCTCCCTCCAAACTCCCAACCCCCAGTCAGTGTTTGAGCCTCCTCGTTCCCCTCACGCACCCGCTCACGCACCCTCGGTGAATCCTTGGTGATGATTTTGGCAACTTTGGGAATAAATGGCAATTCCCACGGGCTTGGCACTCCCAG