Transcript asmbl_13134

Sequence
Transcript Sequence for observation asmbl_13134 of TGE0000117:
TGACTGGAACCCCCATAATGACATTCAGGCCTTTAGCAGAGCTCACCGGATTGGGCAAAATAAAAAGGTAATGATCTACCGGTTTGTGACCCGTGCGTCAGTGGAGGAGCGCATCACGCAGGTGGCAAAGAAGAAAATGATGCTGACGCATCTAGTGGTGCGGCCTGGGCTGGGCTCCAAGACTGGATCTATGTCCAAACAGGAGCTTGATGATATCCTCAAATTTGGCACTGAGGAACTATTCAAGGATGAAGCCACTGATGGAGGAGGAGACAACAAAGAGGGAGAAGATAGCAGTGTTATCCACTACGATGATAAGGCCATTGAACGGCTGCTAGACCGTAACCAGGATGAGACTGAAGACACAGAATTGCAGGGCATGAATGAATATTTGAGCTCATTCAAAGTGGCCCAGTATGTGGTACGGGAAGAAGAAATGGGGGAGGAAGAGGAGGTAGAACGGGAAATCATTAAACAGGAAGAAAGTGTGGATCCTGACTACTGGGAGAAATTGCTGCGGCACCATTATGAGCAGCAGCAAGAAGATCTAGCCCGAAATCTGGGCAAAGGAAAAAGAATCCGTAAACAGGTCAACTACAATGATGGCTCCCAGGAGGACCGAGATTGGCAGGACGACCAGTCCGACAACCAGTCCGATTACTCAGTGGCTTCAGAGGAAGGTGATGAAGACTTTGATGAACGTTCAGAAGCTCCCCGTAGGCCCAGTCGTAAGGGCCTGCGGAATGATAAAGATAAGCCATTGCCTCCTCTGTTGGCCCGTGTTGGTGGGAATATTGAAGTACTTGGTTTTAATGCTCGTCAGCGAAAAGCCTTTCTTAATGCAATTATGCGATATGGTATGCCACCTCAGGATGCTTTTACTACCCAGTGGCTTGTAAGAGACCTGCGAGGCAAATCAGAGAAAGAGTTCAAGGCATATGTCTCTCTTTTCATGCGGCATTTATGTGAGCCGGGGGCAGATGGGGCTGAGACCTTTGCTGATGGTGTCCCCCGAGAAGGCCTGTCTCGCCAGCATGTCCTTACTAGAATTGGTGTTATGTCTTTGATTCGCAAGAAGGTTCAGGAGTTTGAACATGTTAATGGGCGCTGGAGCATGCCTGAACTGGCTGAGGTGGAGGAAAACAAGAAGATGTCCCAGCCAGGGTCACCCTCCCCAAAAACTCCTACACCCTCCACTCCAGGGGACACGCAGCCCAACACTCCTGCACCTGTCCCACCTGCTGAAGATGGGATAAAAATAGAGGAAAATAGCCTCAAAGAAGAAGAGAGCATAGAAGGAGAAAAGGAGGTTAAATCTACAGCCCCTGAGACTGCCATTGAGTGTACACAGGCCCCTGCCCCTGCCTCAGAGGATGAAAAGGTCGTTGTTGAACCCCCTGAGGGAGAGGAGAAAGTGGAAAAGGCAGAGGTGAAGGAGAGAACAGAGGAACCTATGGAGACAGAGCCCAAAGGTAAAGGTGCTGCTGATGTAGAGAAGGTGGAGGAAAAGTCAGCAATAGATCTGACCCCTATTGTGGTAGAAGACAAAGAAGAGAAGAAAGAAGAAGAAGAGAAAAAAGAGGTGATGCTTCAGAATGGAGAGACCCCCAAGGACCTGAATGATGAGAAACAGAAGAAAAATATTAAACAACGTTTCATGTTTAACATTGCAGATGGTGGTTTTACTGAGTTGCACTCCCTTTGGCAGAATGAAGAGCGGGCAGCCACAGTTACCAAGAAGACTTATGAGATCTGGCATCGACGGCATGACTACTGGCTGCTAGCCGGCATTATAAACCATGGCTATGCCCGGTGGCAAGACATCCAGAATGACCCACGCTATGCCATCCTCAATGAGCCTTTCAAGGGTGAAATGAACCGTGGCAATTTCTTAGAGATCAAGAATAAATTTCTAGCTCGAAGGTTTAAGCTCTTAGAACAAGCTCTGGTGATTGAGGAACAGCTGCGCCGGGCTGCTTACTTGAACATGTCAGAAGACCCTTCTCACCCTTCCATGGCCCTCAACACCCGCTTTGCTGAGGTGGAGTGTTTGGCGGAAAGTCATCAGCACCTGTCCAAGGAGTCAATGGCAGGAAACAAGCCAGCCAATGCAGTCCTGCACAAAGTTCTGAAACAGCTGGAAGAACTGCTGAGTGACATGAAAGCTGATGTGACTCGACTCCCAGCTACCATTGCCCGAATTCCCCCAGTTGCTGTGAGGTTACAGATGTCAGAGCGTAACATTCTCAGCCGCCTGGCAAACCGGGCACCCGAACCTACCCCACAGCAGGTAGCCCAGCAGCAGTGAAGATGCAGACTGATACCACCTCCACCGCTGAGCAGTGACCTTCCTCACTTTCTCTTGTCCCAGCTTCTCCCCTGGGGGCCTGAGAGACCCTCACCTTCCTTCTGCCCATCTTCCATGTTGTAAAGGAACAGCCCCAGTGCACTGGGGGAGGGGAGGGAGTGAGGGGCAGTGGTGCCCTTCCTGCAGAAGAGACATGCAGCAGTAGCGCTGGCGCCATCTGCAGGAGCTGGCGGGCTGGCCTTCTGGACCCTGGCTTCTCCCCACTGTAACGCCTGTTACACACAAACTGTTGTGGGTTCCTGCCAGGCTTGAAGAAAATGATCTGAATTTTTTCCTCCTTTTGGTTTTATTTTGTTGGTTTATTTTGTGTTTTCTTTTCTCCTTTTTGGGGGGTATTCAGAGTGGGCTGGGCCCCTGGGCGAGACACAGCTACCTCTGTTGGCATCTTTTTAATACCAGGAACCCAGCGGCTCTAGCCACTGAGCGGCTAAATGAAATAA