Transcript asmbl_28751

Sequence
Transcript Sequence for observation asmbl_28751 of TGE0001202:
CGGGCGGGCGGGTGAGGGGGCGGAGCCCGGGCGGGGCGGGGAGGGCTGCCGGAGGCTTGATTAGGTAGGAGGTGGCGAAGCGCCGGCGGCGGCCGGAAGTAGCCGAAGCCAGCGGCGGAAGTAGCCGAAGCGGCTGGAGCGGGCGGCAAGGCGAGGCGAAAGCTGCACAGGGCCCTACGCGGCCGCCTCAGCATGTCGGACTTCGACGAGTTCGAGCGGCAGCTCAACGAGAATAAACAAGAGCGGGACAAGGAGAACCGGCATCGGAAGCGCAGCCACAGCCGCTCTCGGAGCCGGGACCGCAAACGCCGGAGCCGGAGCCGCGACCGGCGCAACCGGGACCAGCGGAGCGCCTCCCGGGACAGGCGACGACGCAGCAAACCTTTGACCAGAGGCGCTAAAGAGGAGCACGGTGGACTGATTCGTTCCCCCCGCCACGAGAAGAAGAAGAAGGTCCGTAAATACTGGGACGTGCCACCCCCAGGCTTTGAGCACATCACCCCAATGCAGTACAAGGCCATGCAAGCTGCGGGTCAGATTCCAGCCACTGCTCTTCTCCCCACCATGACCCCTGACGGTCTGGCTGTGACCCCAACGCCGGTGCCCGTGGTCGGGAGCCAGATGACCAGACAAGCCCGGCGCCTCTACGTGGGCAACATCCCCTTTGGCATCACTGAGGAGGCCATGATGGATTTCTTCAACGCCCAGATGCGCCTGGGGGGGCTGACCCAGGCCCCTGGCAACCCAGTGTTGGCTGTGCAGATTAACCAGGACAAGAATTTTGCCTTTTTGGAGTTCCGCTCAGTGGACGAGACTACCCAGGCTATGGCCTTTGATGGCATCATCTTCCAGGGCCAGTCACTAAAGATCCGCAGGCCTCACGACTACCAGCCGCTTCCTGGCATGTCAGAGAACCCCTCCGTCTATGTGCCTGGGGTTGTGTCCACTGTGGTCCCCGACTCTGCCCACAAGCTGTTCATCGGGGGCTTACCCAACTACCTGAACGATGACCAGGTCAAAGAGCTGCTGACATCCTTTGGGCCCCTCAAGGCCTTCAACCTGGTCAAGGACAGTGCCACGGGGCTCTCCAAGGGCTACGCCTTCTGTGAGTACGTGGACATCAACGTCACGGATCAGGCCATTGCGGGGCTGAACGGCATGCAGCTGGGGGATAAGAAGCTGCTGGTCCAGAGGGCGAGTGTGGGAGCCAAGAATGCCACGCTGGTGAGCCCCCCGAGCACCATCAATCAGACGCCTGTGACCCTGCAAGTGCCGGGCTTGATGAGCTCCCAGGTGCAGATGGGCGGCCACCCGACTGAGGTCCTGTGCCTCATGAACATGGTGCTGCCTGAGGAGCTGCTGGACGACGAGGAGTATGAGGAGATCGTGGAGGACGTGCGGGACGAGTGCAGCAAGTACGGGCTTGTCAAGTCCATCGAGATCCCCCGGCCTGTGGACGGCGTCGAGGTGCCCGGCTGCGGAAAGATCTTTGTGGAGTTCACCTCTGTGTTTGACTGCCAGAAAGCCATGCAGGGCCTGACGGGCCGCAAGTTCGCCAACAGAGTGGTTGTCACAAAATACTGTGACCCCGACTCTTATCACCGCCGGGACTTCTGGTAGAGGCGGCTGGGGGAGGGTGGGGGCAGGGCTGGCTGGGGGCTTCTCCCCACTCCCGCCCCCCCCTTATCCCCCTCTGAAGACGATGGGCAGAGGAGTGACAGCCGCAGACACACGACAGCCGGCAGCAACTGGAATGGCAGCAATTAAGGGTGGGGGGCGGGGGTTGGGGGGTTG