Transcript asmbl_67000

Sequence
Transcript Sequence for observation asmbl_67000 of TGE0007108:
CCGCGGTTTGTTGGGACACGCCGGCAAGCCGCCTCTCCAGTTATCGGCTCCTCCGAGGAAGGGGGCGGTTGGAGTGGTCTCCATTGTTCGCGGCTTAGGGCGCCATGAGGGGTGACCGAGGCCGAGGTCGCGGAGGGCGCTTTGGTTCCAGAGGAGGCCCAGGAGGAGGGTTCAGGCCCTTTGTGCCGCACATCCCGTTTGATTTCTATTTGTGCGAGATGGCCTTCCCCCGGGTCAAGCCAGCGCCTGATGAAACTTCCTTCAGTGAGGCCTTGCTGAAGAGGAATCAGGACCTTGCTCCTAATTCTGCTGAACAAGCCTCTATCCTTTCTCTGGTGACAAAAATAAACAACGTGATTGACAATTTGATTGTGGCTCCAGGGACATTTGAAGTGCAAATTGAAGAAGTTCGACAGGTGGGATCTTATAAAAAGGGAACGATGACCACGGGGCACAACGTGGCCGACCTGGTGGTAATCCTAAAGATTCTGCCAACGTTGGAAGCTGTCGCTGCCCTAGGGAACAAAGTCGTGGAGAGCCTCAGAGCGCAGGACCCTTCTGAAGTTTTGACCATGCTGACCAACGAAACTGGCTTCGAGATCAGCTCGTCTGACGCGACGGTGAAGATCCTCATCACGACAGTGCCGCCCAACCTCCGGAAACTGGACCCAGAACTCCACTTGGACATCAAGGTGTTGCAGAGTGCCCTAGCAGCCATCCGGCACGCCCGCTGGTTTGAGGAAAATGCCTCTCAGTCCACAGTTAAAGTTCTCATCAGACTGCTGAAGGACCTGAGGATTCGTTTTCCTGGCTTTGAGCCCCTCACACCCTGGATCCTCGACCTACTCGGGCACTATGCCGTGATGAACAACCCCACCAGACAGCCTTTGGCCCTAAACGTGGCATACAGGCGCTGCTTGCAGATCCTGGCCGCAGGACTGTTCCTGCCAGGGTCGATGGGCATCACGGACCCCTGTGAGAGTGGCAACTTCAGAGTACACACAGTCATGACTCTGGAACAGCAGGACATGGTCTGCTACACGGCTCAGACGCTGGTCCGGATACTCTCGCATGGTGGCTTCAGGAAGATCCTTGGCCAGGAGGGTGATGCCAGCTATCTTGCTTCTGAAATATCTACCTGGGATGGAGTGATAGTGACACCTTCAGAAAAGGCTTATGAGAAGCCACCAGAGAAGAAGGAAGGAGAAGAAGAGGAGGAGAATGCAGAAGAACCACCTCCGGGAGAGGAGGAGGAAAGCATGGAGACGCAGGAGTGACCTTGCCTTCACCCTCTTTCTTACCCAAGGGGAAGGAAGACCGGAGCCTAGGCTAACTGCCACTGGGCTTTATATGGTGGCATTTCTGAGGGATGGGGAGACGGGGGAAAAAAAACTCTATGGAAGGAAGTGTCGTCCCACAGACTTCTGCCGTTGGCCTAGTAGCCAGAAGTCCCCCAGTGAAGCAGGATACCAACTTTTCTTCCTTAATACTGTAAACTCCCCAGCTTCCAGAAACCTCTCAACCAGTACTTTGTTGTTGAAATGTGAACTGTTGATGTCTGGAAATTTTTTTCTAGGAAAAATGATTAAAGTACTTCCTAGTAGGGCTCTTGATCTTGTTTTTCCTTGACAATCTAGCAACCTTTGTTTTGGCTTTTTATACTCC