Transcript asmbl_66802

Sequence
Transcript Sequence for observation asmbl_66802 of TGE0007081:
ACGAGAGAAGAAACTTTAATGACATGCCTTCATTTCCAATCCCCAGATTCGGGCTCTCAGGGGGCGCTTCGGGGGTGCGCCCTGGGGCCCGGCAAGGCCGCGGGGAGGCGTGGGGGTCCGTCTCAGGGCCTGGAGGGAGGGTTCTCGGCCAGGGGCGGGGCGGGATGGCCCGCGTCGGAGACTTCTGCTCCCAGGTACTCCTGGGATAGGAGTCAAAGCCCAGAAAAGGCGCAGTATTCTACCTTGTAAATACTGTTATTTGTATATACTGTAAATGATGACATCGGTGGGCACTAACCGAGCCCGGGGAAACTGGGAACAGCCTCAAAACCAAAACCAGACACAGCACAAGCAGCGGCCACAGGCCACTGCAGAACAAATTCGACTTGCACAGATGATTTCGGACCATAACGATGCTGACTTTGAGGAAAAAGTGAAACAATTGATTGATATCACAGGCAAGAACCAGGATGAATGTGTCATTGCTTTGCATGACTGCAATGGAGATGTCAACAGAGCCATCAATGTACTGCTGGAAGGAAACCCAGATACGCATTCCTGGGAGATGGTCGGGAAGAAGAAGGGAGTTTCAGGACAGAAGGATGGTGGCCAGACGGAGTCCAACGAGGAAGGCAAAGAAAATCGAGACCGGGACAGAGACTATAGTCGGCGACGTGGTGGGCCACCAAGACGTGGGCGAGGTGCCAGCCGTGGACGAGAGTTTCGGGGTCAGGAAAATGGATTGGATGGCACCAAGAGTGGAGGGCCTTCTGGAAGAGGCACAGAAAGAGGGCGAAGAGGTCGCGGACGAGGCAGAGGTGGCTCCGGTAGGCGGGGAGGAAGGTTTTCTGCTCAAGGAATGGGAACCTTTAACCCAGCCGATTATGCAGAGCCAGCCAATACTGAAGATAACTATGGCAATAATAGCGGCAATACGTGGAACAACACTGGCCACTTCGAGCCAGATGATGGGACGAGACTTGATTTCATTGGGGTTGAGGGGTCAAATTATCCCCGAAAATTTGAGACTGCTCCTGGTGCGTGGAGGACTGCAACCGAGGAGTGGGGAACTGAAGATTGGAATGAAGATCTTTCTGAGACCAAGATCTTCACTGCCTCTAATGTGTCTTCAGTGCCTCTGCCTGCAGAGAATGTGACAATCACTGCTGGTCAGAGAATTGACCTTGCTGTTCTACTGGGGAAGACACCGTCTTCAATGGAGAATGATTCCTCTAATCTGGATCCATCTCAGGCTCCTTCTCTTGCCCAGCCTCTGGTTTTCAGTAACTCGAAGCAGAGCACCATATCACAGCCTGCTTCAGGGAGCACGTTTTCTCATCACAGTATGGTGAGCATGTTAGGGAAAGGATTTGGTGATGTCGGCGAAGCTAAAGGCGGCAGCACCACGGGCTCCCAGTTCTTGGAGCAGTTCAAGACTGCGCAGGCCCTGGCTCAGCTGGCCGCCCAGCATTCCCAGTCCGGAACCGCCACCACCTCCTCTTGGGACCTGGGCTCCACCACGCAGTCCCCTTCGCTGGTGCAGTACGATTTAAAGAACCCAAATGATTCAACAGTGCACAGCCCCTTCACAAAGCGCCAGGCTTTCACCCCATCTTCAACCATGATGGAGGTGTTCCTTCAGGAGAAGCCACCTGCAGCAGCTACCTCCACAGCTGCACCTGCACCCCCCTCTTCTCCGCTGCCAAGCAAACCTGCCTCGGCGCCACAAATGTCCCCTGGGTCTTCAGACAACCAGTCCTCCAGCCCTCAGCCGGCTCAGCAAAAACTGAAGCAGCAGAAGAAAAAAGCCTCCTTGACTTCTAAGATTCCTGCTCTGGCTGTGGAGATGCCTGGCTCGGCAGATATCTCAGGGCTAAACCTGCAGTTCGGGGCCTTGCAGTTTGGGTCGGAGCCTGTCCTTTCTGATTACGAGTCCACCCCCACCACGAGCGCCTCTTCAAGCCAGGCTCCGAGTAGCCTCTATACCAGCACGGCCAGCGAGTCTTCGTCCACAACGTCATCCAACCAGAGCCAGGAGTCCGGGTATCAGAGTGGCCCAATTCAGTCAACAACCTATACCTCCCAAAACAGTGCTCAGGGCCCTCTGTATGAACAGAGATCCACACAGACTCGGCGGTACCCCAGCTCCATCTCTTCATCACCCCAAAAGGACCTGACTCAGGCAAAGAATGGCTTCAGTTCTGTGCAGGCCACGCAGTTACAGACCACGCAATCTGTCGAAGGTGCTACAGGCTCTGCCGTGAAATCTGACTCACCTTCCACTTCTAGCATCCCCCCACTCAGCGAAACGGTCTCTGCAGCCTCCTTACTGACGACGACCAATCAGCACTCGTCCTCCCTGGGTGGCTTGAGCCACAGTGAGGAGATTCCAAATACTGCCACCACACAACACAGCAGCACGTTGTCCACGCAGCAGAACTCCCTGTCCACATCAGCATCTTCCGGGCGCACTTCGACGTCCACTCTTCTGCACACGAGCGTGGAGAGTGAGGCGAATCTCCATTCTTCCTCCAGCACTTTCTCCACCACGTCCAGCACGGTCTCTGCACCCCCCGCAGCGGTCAGCGTCTCCTCCGGTCTCAGTAGTGGCAGTAGCCTGGGCCTCAGCCTCGGCAGCAGCTCCACCGTCACGGCCTCGACACGAAGCTCAGTTGCCACGACTTCAGGAAAAGCTCCTCCTAACCTCCCGCCTGGGGTCCCGCCGTTGTTGCCTAATCCGTACATCATGGCTCCGGGGCTGTTACATGCCTACCCGCCCCAAGTGTATGGTTATGACGACTTGCAGATGCTTCAGACGAGATTTCCGTTGGATTACTACAGCATCCCGTTTCCCACGCCCACCACGCCGCTGACTGGGAGGGACGGTAGCCTGGCCAGCAACCCTTATTCCGGTGACCTCACAAAGTTCGGCCGCGGGGATGCCTCCTCCCCGGCCCCGGCCACAACCTTGGCCCAGCCCCAGCAGAACCAGACGCAGACACACCACACCACACAGCAGACGTTCCTGAACCCGGCGCTGCCTCCCGGCTACAGCTACACCAGCCTGCCGTACTACACAGGGGTGCCGGGGCTCCCCAGCACCTTCCAGTACGGGCCTGCCGTGTTCCCTGTGGCTCCTACCTCTTCTAAGCAGCATGGCGTGAACGTCAGCGTGAATGCATCGGCCACCCCCTTCCAGCAGCCAAGCGGGTACGGGTCTCACGGATACAACACTGGAAGAAAATATCCACCCCCTTACAAGCATTTCTGGACGGCAGAGAGCTAATTTGGCCCAAGGCTGGGGGCTGTGTTTTGTGTGTGTGTATGTTTGCACTGAAGTCTTGTTTCAGAAACCAGAGCACTGAGGAGAGCCTGCCGAGCTGTGGCCACGGCCTGCGTGGCTTGGGGAAATGAGTTGGTGGATGCCTTCTGGGCTCTTGAACTTGCCCGTCCCCCGCTTCCCCTCCTCCATGTGTCTGACCCTGTCTTACCCATTTCGAGTCCGAGCGGTGCAGCACCTCCGAAGCATCGATGCACACACACCCGCTGTTGCTTTTAATTTCTGGAAGGCATGTGGTTGCAACTTGTAACAAAAACCTTTGTAGTCTTCAATAAACTGTGGTGTTTCTTTAGCTAA