Transcript asmbl_66766

Sequence
Transcript Sequence for observation asmbl_66766 of TGE0007072:
CCGGCTTCCAGGAACAGGTGAGAGGGTTTGTGACCGGCTCTCGGAGACTGCGGGTGGGGATGTGGCCTTACCTCTGTAGCACAGGGGGCCCGGCCTGTTGCGTCGGAGTCCCCCCCCGTGTTTGGGGTCGATGGGCCCGACTGGCTGACCCTCTGGATACGCGGAAACTCCCGAGCTCTGTCGTGAGCTTTCTAGGCACCCCTAATATGCCCGATCCCGGGTTGCTCCTCTACGACGCGCCCTCCTTCCTCGCCCGGCGTTGCTCCGGGGCTGTCTCCGCTGTCCCGGCGACCACTGTGGGGCTCGGGGCGCCCAGTCTCAGCCCCAGGCTACATGCCGTAGCACGCAGGGGTTCCGGCTCCATTTCTTCTCTTCTTGGGGGCGAGCCCGCACCCCTTTCACCGCCTACCAGGGAAGACCTGGGTTCTAGACCTGTCGCTGCCACTGCCGTCGTATCTCCTTACCTTCTAGAACCTCACTTTGACCAATAAAATAGGGTTACTTAAGGGTCCTCTCAGGCCCTAGTCCTGAGGTACTTTGCTCTTTCTCCAAGACTTGGAGGAAGAAGCCGAGAGTAGCAATTCCAGAGGCTCCCTGGAGGAGGAGTTGGCGGGCGAGGAGGATAACATGAGGTGGCATTAAGTTCTAGCCATCTGTTTTAAGTGTGATCAGTGGAGTCTCAGCCACCCAGCCATCCTTTTGGTTCACTGCATTTCCTTCTTTCTGTAAATGCTCTGAAGCTCAGTCCAGAAGAGGGCGGGGCCAGGGTCCAGAAGTAAAGGGCTAGGGGTGTGTGTATGGGGGTGACCTGGGGAGCTGCCACCGTGTATCTGCCTTTGGTGCTTGCCCCTGCAGGGAGTGCTGGGTGCTTCCTCCCTATGCCACCCCCACATGATGCCCCTGTCCCGCTGGCTGAGGTCTGTGGGGGTCTTCTTGCTGCCAGCCCCCTGCTGGGTACCCCGGGAGAGGTGGCTGGGTACCCTGCGGCGGCCCTCCCTGGTGTATGGGGGCTCAGTCCTGGGGGCCTGGCACAGTGCCGGCTGCTGGTGCCAAGCGTGGACAGAGGAGCCTCGGGCACATTACTCCTCCCTCAGAATGAATGGAGATCAGAAATCGGATGCTTTCATGCAAGAAAAGCAGAATTTCCTCCAGTGTTTCCCAGTGATCATCAAGGTGCTGACCGATGACTTGGAACACCCAGAGATAAAGGAAGTTCTTGCCCGGCTCAAGCAGGTCCTGGAGTACAATGTCATCGGTGGCAAGCATCAGCGGGGTCTGCTGGTGCTGATCGCGTTCCGGGCGCTGGTCGAGCCGAGAAAGCAGGACGCCGCGAGTGTGCATCGGGCCCTGGTGGTGGGCTGGTGCGTGGAGATGCTCCAGACCTTCTTTCTGGTGCTAGACGACATCATGGACTCATCCATCACCCGACGGGGGCAGCTCTGCTGGTATCGGAAGCCAGGCGTTGGCTTGGATGCCATCAACGACGGTCTTCTCATCGAAACGTGTATCTACCGCCTGCTAAAGCACTACTGCCGGGAGCAGCCCTATTACCTGAACCTGATGGAGCTCTTCCTGCAGAGTTCCTACGTGACAGAGATTGGACAGAGCCTGGACCTCATCGCAGGCCTCCAGGACAAGGTGGATCTCTCAGGATTCACTGAAAAGAGGTACAAGACTATCGTCAAGTACAAGACAGCTTTCTACACTGCCTACCTTCCCGTGGCTGCAGGCATGTACATGGCGGGCATCGATGGGGAGAGGGAGCATGCCACCGCCAAGAAGATCCTGTTCGAGATAGGGGAGTTCTTCCAGATCCAGGACGATTACCTTGATGCCTTTGGGGACCCCAGTGTGACAGGCAAGATTGGCACTGACATCCAGGACAACAAATGCAGCTGGCTGGTGGTTCAGTGTCTGCAGAGGGCCTCCCCGGAGCAGCGCCAGGTCCTGCAGGAGAACTATGGGCAGAAGGAAGCCGAGAAGGTGGCCCGGGTGAAGGCGCTCTACGAGGAGCTGGACCTGCCGGGCGTGTTCTCGCGGTACGAGGAGGACAGCTACCGCCGCATCACGGGGCTCATCGGGGACCTCGCCCCGCCCCTGCCCCCTTCCATCTTCCTGGAGCTGGCACACCACTTCTACAAGCGCAAGAAATGAACTGGAGTGTGGCGCGGGGGGGCCCAATAAACGACACAAGTCCTCGC