Transcript asmbl_66742

Sequence
Transcript Sequence for observation asmbl_66742 of TGE0007064:
CTCCTTCCATTCCCAGGACCTATTAGAGCGATTGCCCAGACGCCGGTGACTCAGTGTTCGCGGGAGCGCCGCAGCCACACCAGCCAACCCGGATCCTAGGTCTGACAGCGCCGGCCCGGGTCCCCGCCTGCCAGGAGTAAGCCGACAGGCGGCCGGCCCCGCGTGTCCGACCCAGAGCCACCTCTGTCCTTCGACCCGAGCTCCGCGCCCTTCCTGCGATCCCTGCCCCGCGGGCAGCGCTGCCATCCTGCCGGCCATGGAGACTCCGTCCCAGCGGCGCGCCACCCGCAGCGGGGCGCAGACCAGCTCCACCCCGCTGTCGCCGACCCGCATCACCCGGCTGCAGGAGAAGGAGGACCTGCAGGAGCTCAACGACCGCTTGGCGGTCTACATCGACCGTGTGCGCTCTCTGGAGACGGAGAACGCGGGTCTGCGCCTTCGCATCACCGAGTCCGAGGAGGTGGTCAGCCGCGAGGTGTCCGGCATCAAGGCCGCCTACGAGGCCGAGCTCAGCGATGCCCGCAAGACCCTCGACTCGGTGGCCAAGGAGCGCGCCCGCCTGCAGCTGGAGCTGAGCAAAGTGCGCGAGGAGTTTAAGGAGCTCAAAGCGCGCAATACCAAGAAGGAGGGTGACCTGATGGCCGCCCAGGCCCGGCTCAAGGACCTGGAGGCTCTGCTCAACTCTAAGGAGGCCGCACTGAGCACGGCCCTCAGCGAGAAGCGCACGCTGGAGGGCGAGCTGCATGACCTGCGGGGCCAAGTGGCCAAGCTCGAGGCAGCCCTGGGGGAGGCCAAGAAGCAGCTTCAGGACGAAATGCTGCGGCGGGTCGATGCCGAGAACAGGCTGCAGACCCTGAAGGAGGAGCTAGACTTCCAGAAGAACATCTACAGCGAGGAGCTGCGTGAGACCAAGCGCCGCCACGAGACCCGGCTGGTGGAGATTGACAACGGCAAGCAGCGGGAGTTTGAGAGCCGGCTGGCCGACGCCCTGCAGGAGCTGCGGGCCCAGCACGAGGACCAGGTGGATCAGTACAAGAAGGAGCTGGAGAAGACCTACTCTGCCAAGCTGGACAACGCCAGGCAGTCGGCCGAGAGGAACAGCAACCTGGTGGGGGCCGCCCACGAGGAGCTGCAGCAGTCCCGCATCCGCATAGACAGCCTGTCCGCCCAGCTCAGCCAGCTGCAGAAGCAGCTGGCAGCCAAGGAGGCGAAGCTGCGGGACCTGGAGGACTCGCTGGCCCGCGAGCGTGACACCAGCCGGCGGCTGCTGGCGGAGAAGGAGCGGGAGATGGCGGAGATGCGGGCGCGGATGCAGCAGCAGCTGGACGAGTACCAGGAGCTGCTGGACATCAAGCTGGCGCTGGACATGGAGATCCACGCCTACCGCAAGCTGCTGGAGGGCGAGGAGGAGAGGCTCCGCCTGTCCCCCAGCCCCACCTCGCAGCGCAGCCGAGGCCGTGCCTCCTCCCACTCGTCCCAGACGCAGAGTGGGGGCAGCGCCACCAAGAAGCGGAAGCTGGAGGCCGCCGAGAGCCGTAGCAGCTTCTCCCAGCACGCGCGCACCAGCGGGCGCGTGGCGGTGGAGGAGGTGGACGAGGACGGCAAGTTCGTGCGGCTGCGCAACAAATCCAGCGAGGACCAGACCATGGGCAACTGGCAGATCAAGCGCCAGAACGGAGATGACCCCTTGCTGACCTACCGCTTCCCACCGAAGTTCACCCTGAAGGCCGGGCAGGTGGTGACGATCTGGGCTGCAGGAGCTGGGGCCACCCACAGCCCCCCGACCGACCTGGTGTGGAAGGCACAGAACACCTGGGGCTGTGGCAACAGCCTGCGCACGGCCCTCATCAACTCCACCGGGGAGGAGGTGGCCATGCGCAAGCTGGTGCGCTCGGTGACTGTGGTCGAGGATGACGAAGACGAGGATGGAGATGACATGATCCATCACCACCACGTGAGTGGCAGCCGCCGCTGAGGCCACGCCCACACCCACACCCACACCGGGCGCCAGCCAGGCCCGGCCGCCTCGCCCAGCCTCCCCACACAAAATCTTGTCATTAAAGAGTGTTTTGGAACTTGA