Transcript asmbl_65293

Sequence
Transcript Sequence for observation asmbl_65293 of TGE0010681:
GCCGGTGCGACAGCCTGGAATTGTGGGGGTTGTGTCTGCCCCTTGGCTGTCAGGCGGGAAGCCGAAGGTCTCCCTGTGCCTCCCGAGGGCCTGCCCCTATCTAGGATGGCTCCTCACGGCATGCTGCTCGGGCTGCTGATGGCTTCCTGCTTCATCTTCTGCCTCAGTCATCAGAACCCAGAGTTTGCACTGACCTACCCAGAGAGGAGCAGCACCAAAGAAACAGAGAGAAAGGAAACCACAGCAGAGGAGGAGCTGGACCCCGAGGTTCTGAATGTGTTTCACCCGACCCATGAGTGGCAGGCCCTTCGGCCAGGTCAGGCTGTCCCTGCAGGATCCCATGTGCGGCTGAATCTTCAGACTGGGACAAGAGAAGTGAAACTCCAAGATGAGGACAAGTTCCAAAATACTTTGAAAGGGTCGAAAAAAGGCAAAAGGCTGGACATCAATACCAACACCTACACCTCTCAGGACCTCAAGAGTGCACTGGCAAAATTCAAAGAAGGGACAGAGATGGAGAGTTCAAAGGAGGACAAGGCAAGGCATGCTGAGATTAAACGGCTTTTCCGCCCCATTGAGGAGCTGAAGAAGGACTTTGAAGAGCTGAATGTTGTCATTGAGACTGACATGCAGATCATGGTACGGCTGATCAACAAATTCAATAGTTCCAGCTCCAGCCTGGAGGAGAAGATTGCTGCACTCTTCGATCTTGAATATTATGTCCATCAGATGGATAATGCACAGGATCTGCTTTCCTTCGGTGGCCTTCAAGTGGTGATCAATGGGCTGAACAGCACAGAGCCCCTGCTAAAGGAGTATGCTGCGTTTGTGCTGGGGGCAGCCTTTTCCAGCAACCCAAAGGTCCAGGTGGAGGCCATTGAGGGGGGAGCTCTGCAGAAGCTGCTAGTAATCCTGGCCACGGAGCAGCCTCTTACTGTAAAGAAGAAGGTCCTGTTTGCACTGTGCTCCCTGCTACGACACTTTCCCTATGCCCAGCAACAGTTCCTGAAGCTGGGGGGGCTACAAGTCCTAAGGAGCCTAGTGCAAGAGAAGGGCACGGAGGTGCTGGCCGTGCGTGTGGTCACCCTGCTCTATGATCTGGTCACTGAGAAGATGTTTGCCGAAGAGGAGGCCGAGCTAACCCAGGAGACATCCCCAGCGAAGCTGCAGCAATATCGCCAGGTGCACCTCTTGCCAGGCCTGCGAGAACAGGGCTGGTGCGAGATCACTGCCCACCTCCTGGCACTGCCTGAGCATGATGCCCGTGAAAAGGTGCTGCAGACGCTGGGCGCCCTCCTTGCCACCTGCCGGGACCACTACCATAAGGACCCACAGCTCAGCAGGATGCTGGCCAGCCTGCAGGCTGAATACCAGGCGCTGGCTACCCTGGAGCTTCAAGGTGGCGAGGACGAGGGCTACTTCCGGGAGCTGCTGGGCTCCATCAACAGCTTGCTGAAGGAGCTGAGATGAGGCTGCCCCAGTGGGGGAATGGTCTGGAACGCTGCTAGTAAGGCTGAGAGGAACTTGCTTGGGTGGGTTCTTCAGGGGACAGCAGGCAGGAGGGAGGCCTGAGCATTATCTGGGCAGTGCTGGCCTGGCCATTAAATGGAGACATGAATGCCATTGTTTGTCTACAGTATGTCTGCAGCCCTGTGGTAGTCAGATGGGTTATTGGGTGATAGGTCCCTAAGCGCCGCTAGTGACATGCTGCATGGTCAGCCCAGAACAGCCAGCAAGTAACAGACCCTATGGGAAGGGTCTGGGCTCAAAGGTTGGGAAACCTTGACTGGGACCAGTAGTTCTATGACCTTGGGAAGTCGCTTAACTTCCCTGAGCCTCTTTCCTCATCTGTCAAAGGGGAATGCCATTAAATGAGAGAAAATA