Transcript asmbl_65094

Sequence
Transcript Sequence for observation asmbl_65094 of TGE0006960:
CTGCCTACCACAGCTCCCAGAAAGGAAGGTAGAATTTGTTTTTATTGCCTGGTTTCTCATGGGAGTTTCCTTTTGCCTGCTAAAATCTGTGAACTGCCTATTCAGACCTACCTCTTCCAGAAAACCCTCCAGGCTGTTTTTGCCCATACTATTCTTCAAATTCCTACAACAGATAGTCTGACTAAGCAGTTTAATACTTGTCGTGTACAGCCCTTATCCTTTCATTGTTCTCACTTCATCTTTCTGATGGCACTCTGAGGCAACTTGAAGACAAAGGGCTTCTATCTCTTCTACAATCCCTAGCAGAAATAGTGGGTGCTCAGTTAACCTAGTGGCTGATTGAGGGTTGATCCAGCCAGTCCTCTAGCTCCTCCCATAGTCTTCCCAAACTGATCCATATTCTTCCTAGTTTCCCAAAATCATTCTCCTTACTGGGCTGAAAAAAGGAGGGGGTGGGGTTAGAATGACCAGTTGCCTTTCCTAAATCTGACCACCTTAAATGAGGGGCTGAACCCCCAATCTTGGCCTCATATATCTTATATTCTGGTGGGTTTTCTAATTCACTCTAGTAATGGAACCATTCAAATGCAATCTAGTGGGAAACCTCAATAATAAACAGACCATCATAGGGATGGGAGAGCCCAGAGGTGGCCTGTGTGGCCAGAGTGCTGAACTGTGCTATTCTAGCCCATGTCCAGGGGTAAAGGTGAGCCTTTCCCTCATTTGGCAACTGTTCTCACCTCTGGGGCCTACCCTGGGGATGTGGGATATATCCCTGCAGGCAAAACCCCCAACCCACAGGCTACAGAGTGCTGACCACAGGCCTGGGTGTGTCCCCTTCCTAGTTCCCCACAGCCACCACCACCCTTCAGAATGGCCAACAGGGGACCTGCTTATGGTCTGAGTCGGGAGGTGCAGCAGAAGATTGAGAAGCAGTATGATGCAGACCTGGAGCAGATCCTGATCCAGTGGATTACAGCCCAGTGCCGCAAGGATGTGGGCCGGCCCCAGCCTGGGCGTGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTGTGTGAGCTCATTAATGGACTATACCCTGAGGGGCAGGCCCCAGTGAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATCAACACCACAGACATCTTCCAGACTGTGGACCTGTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACACTGATGAACCTGGGTGGGCTGGCAGTGGCCCGGGACGATGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAGTCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGCTGCAAGAGGGCAAGAACGTGATTGGGCTGCAGATGGGCACCAATCGTGGGGCATCTCAGGCAGGCATGACCGGCTATGGGATGCCACGCCAGATCCTCTGATCCATCTCCAGCTCTTGCATCTACTCTCCCGTGGATGGTTAATATATATAGATAGATAGATAGATATGCATATCCATCTACATATATATATTAGCAGTGACATTCCCCAAGAGCTCCCTGAGCTTTCAACCTCCCCACTGCTAGGGTGAGGGCCTGGCCTGGCCTATCTCCTCTGGGGGTGCCCAATGGTAGCCTCTCCCCATGTGCTTACTAATACATTCCCTTCTCCAAACCCACAAAAACTGGACCAACTGGCCTCTTTTCTCCTGGGACCAAAATTTAGGGCTTCTTCCTTCCCCCACCCCATACCTCTTCTTCTCTGATCTCTGTGCCCTCAATCCATTCCTTGGCTGGGGGTTGGCAATGCTACCTTTGGACCTTCCTTCCACAAACATGCCTCACCCACAGCTGTGGCTACAGGGACTTAATTTATAAGGAGGGGCCAGTAGCGGCTGCCGCCCCTGCCGCAGCTGGACTGGGTTCACCACACATTGGAGGCAGCCTGCCCGGGCAGAGGCCCTCTTGGCTTCTCATTTTCCATTCCCCTCTCTGTGGCTAAGGGGTGCGGTGAGGGGACAGGGGATGGCGGGGAGCTGCCCACTCTGGGCTGGGGCTCGAAGAATCTGAGTTTACTGATTTCAATAAAGAATCTTTGTTTTTTTTGATGGACTCTGGCTA