Transcript asmbl_65093

Sequence
Transcript Sequence for observation asmbl_65093 of TGE0006960:
GTCCGAGGCGGGAGCGGCTGAAAACCTCCAGCCCGGCCCGAGCGCACCACTTGCCTTGCAGCCCCGCCAGGAGTTCGCGCTCTCTGCACTACCCTACGTTCCCCACAGCCACCACCACCCTTCAGAATGGCCAACAGGGGACCTGCTTATGGTCTGAGTCGGGAGGTGCAGCAGAAGATTGAGAAGCAGTATGATGCAGACCTGGAGCAGATCCTGATCCAGTGGATTACAGCCCAGTGCCGCAAGGATGTGGGCCGGCCCCAGCCTGGGCGTGAGAACTTCCAGAACTGGCTCAAGGATGGCACGGTGCTGTGTGAGCTCATTAATGGACTATACCCTGAGGGGCAGGCCCCAGTGAAGAAGATCCAGGCCTCCACCATGGCCTTCAAGCAGATGGAGCAGATCTCTCAGTTCCTGCAAGCAGCTGAGCGCTATGGCATCAACACCACAGACATCTTCCAGACTGTGGACCTGTGGGAAGGAAAGAACATGGCCTGTGTGCAGCGGACACTGATGAACCTGGGTGGGCTGGCAGTGGCCCGGGACGATGGGCTTTTCTCTGGGGATCCCAACTGGTTTCCTAAGAAGTCCAAGGAGAACCCTCGGAACTTCTCGGACAACCAGCTGCAAGAGGGCAAGAACGTGATTGGGCTGCAGATGGGCACCAATCGTGGGGCATCTCAGGCAGGCATGACCGGCTATGGGATGCCACGCCAGATCCTCTGATCCATCTCCAGCTCTTGCATCTACTCTCCCGTGGATGGTTAATATATATAGATAGATAGATAGATATGCATATCCATCTACATATATATATTAGCAGTGACATTCCCCAAGAGCTCCCTGAGCTTTCAACCTCCCCACTGCTAGGGTGAGGGCCTGGCCTGGCCTATCTCCTCTGGGGGTGCCCAATGGTAGCCTCTCCCCATGTGCTTACTAATACATTCCCTTCTCCAAACCCACAAAAACTGGACCAACTGGCCTCTTTTCTCCTGGGACCAAAATTTAGGGCTTCTTCCTTCCCCCACCCCATACCTCTTCTTCTCTGATCTCTGTGCCCTCAATCCATTCCTTGGCTGGGGGTTGGCAATGCTACCTTTGGACCTTCCTTCCACAAACATGCCTCACCCACAGCTGTGGCTACAGGGACTTAATTTATAAGGAGGGGCCAGTAGCGGCTGCCGCCCCTGCCGCAGCTGGACTGGGTTCACCACACATTGGAGGCAGCCTGCCCGGGCAGAGGCCCTCTTGGCTTCTCATTTTCCATTCCCCTCTCTGTGGCTAAGGGGTGCGGTGAGGGGACAGGGGATGGCGGGGAGCTGCCCACTCTGGGCTGGGGCTCGAAGAATCTGAGTTTACTGATTTCAATAAAGAATCTTTGTTTTTTTTGATGGACTCTGGCTA