Transcript asmbl_13132

Sequence
Transcript Sequence for observation asmbl_13132 of TGE0000115:
GCCATTAGTCCAGGACTCTTCAAACCCTTAGGGATCTCTGCAGGAGCTGTCCAGACAGCTGGTAAGAAGGGACCCCAGTCCCTATTTAATGCTCCTCGAGGCAAGAAGCGCCCAGCACCTGGCAGTGATGAGGAAGAGGAGGAGGAAGACTCTGAAGAAGATGGTATGGTGAACCACGGGGACCTCTGGGGCTCCGAGGACGATGCTGATACGGTAGATGACTATGGAGCTGACTCCAACTCTGAGGATGAGGAGGAAGGTGAAGCGTTGCTGCCCATTGAAAGAGCTGCTCGGAAGCAGAAGGCCCGGGAAGCTGCTGCTGGGATCCAGTGGAGTGAAGAGGAGACCGAGGACGAGGAGGAAGAGAAAGAAGTGACCCCTGAGTCAGGCCCCCCAAAGGTGGAAGAGGCAGATGGGGGCCTGCAGATCAATGTGGATGAGGAACCATTTGTGCTGCCCCCTGCTGGGGAGATGGAGCAGGATGCCCAGGCTCCAGACCTGCAACGAGTTCACAAGCGGATCCAGGATATTGTGGGAATTCTGCGTGATTTTGGGGCTCAGCGGGAGGAAGGGCGGTCTCGTTCTGAATACCTGAACCGGCTCAAGAAGGATCTGGCCATTTACTACTCCTATGGAGACTTCCTGCTTGGCAAGCTCATGGACCTCTTCCCTCTGTCTGAGCTGGTGGAGTTCTTAGAAGCTAATGAGGTGCCTCGGCCCGTCACCCTCCGGACCAATACCTTGAAAACCCGACGCCGAGACCTTGCACAGGCTCTAATCAATCGTGGGGTTAACCTGGATCCCCTGGGCAAGTGGTCAAAGACTGGACTAGTGGTGTATGATTCTTCTGTGCCCATTGGTGCTACCCCCGAGTACCTGGCTGGGCACTACATGCTGCAGGGAGCCTCCAGCATGTTGCCCGTCATGGCCTTGGCACCCCAGGAACATGAGCGGATCCTGGACATGTGTTGTGCCCCTGGAGGAAAGACCAGCTACATGGCCCAGCTGATGAAGAACACGGGTGTGATCCTTGCCAATGACGCCAATGCTGAGCGGCTCAAGAGTGTTGTGGGCAACTTGCATCGGCTGGGAGTCACCAACACCATTATCAGCCACTATGATGGGCGCCAGTTCCCCAAGGTGGTGGGGGGCTTTGACCGAGTACTGCTGGATGCTCCCTGCAGTGGCACTGGGGTCATCTCCAAGGATCCAGCCGTGAAGACTAACAAGGATGAGAAGGACATCCTGCGCTGTGCTCACCTCCAGAAGGAGTTGCTCCTGAGTGCTATTGACTCTGTCAATGCGACCTCCAAGACAGGAGGCTACCTGGTTTACTGCACCTGTTCTATCACAGTAGAAGAGAATGAGTGGGTGGTAGACTATGCTCTGAAAAAGAGGAATGTGCGACTGGTGCCCACGGGCCTAGACTTTGGCCAGGAAGGTTTTACCCGCTTTCGAGAAAGGCGCTTCCACCCCAGTCTGCGTTCTACCCGACGCTTCTACCCTCATACCCACAATATGGATGGGTTCTTCATTGCCAAGTTCAAGAAATTTTCCAATTCTATCCCTCAGTCCCAGACAGGAAATTCTGAAACAGCCACACCTACAAATGTAGACTTGCCTCAGGTCATCCCCAAGTCTGAGAACAGCAGCCAGCCAGCCAAGAAAGCCAAGGGGGCTGCAAAGACAAAGCAGCAGCTGCAGAAACAGCAACATCCCAAGAAGGCCTCCTTCCAGAAGCTGAATGGCATCTCCAAAGGGGCAGACTCAGAATTGTCCACTGTACCTTCTGTCACAAAGACCCAAGCTTCCTCCAGCTTCCAGGATAGCAGTCAGCCAGCTGGAAAAGCCGAAGGGATCAGGGAGCCAAAGGTGACTGGGAAGCTAAAGCAACGATCACCTAAATTACAGTCCTCCAAGAAAGTTGCTTTCCTCAGGCAGAATGCCCCTCCCAAGGGCACAGACACACAAACACCGGCTGTGTTATCCCCATCCAAGACTCAGGCCACCCTGAAACCTAAGGACCATCATCAGCCCCTTGGAAGGGCCAAGGGGGTTGAGAAGCAGCAGTTGCCAGAGCAGCCTTTTGAGAAAGCTGCCTTCCAGAAACAGAATGATACCCCCAAGGGGCCTCAGCCTCCCACTGTGTCTCCCATCCGTTCCAGCCGCCCCCCACCAGCAAAGAGGAAGAAATCTCAGTCCAGGGGCAACAGCCAGCTGCTGCTATCTTAGATGGTTGAAAACTAGACGGGTGGCTCACTGCCATTGTCACCAGGTTGGAACTCTTGCCTCTGTGAGGATGCCTTCTCTACTGTGCATACCCATGAAATTTAATACACATTTTAAAA