Transcript asmbl_63834

Sequence
Transcript Sequence for observation asmbl_63834 of TGE0006898:
CGGTCATTTAGGGCCCGTATCTGGGTGACTTCTTGGTTGCCCAGTTGCTGTCGGCTCCCCACCCCCAGCTCCTGTGCGGTCCCGCGGGCCTCCCGATTTCGGCTTGCTTTCCCCCTTTCGGGACCTCCCTCTCCGGTTCCCTCTGGGCCTTCAGCCCCTGATTGCCCGGGCTTGCCGCGCCGTCGCTCGTCGCTGTTGTCTGAGGAAAGATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCTGAAGTTGCAAGACCAATTCCCCACATAGGGGCTGATTACATTCCAACAGAGGAAGAAAGAAGAGTCTTCGCAGAATGCAATGATGAAAGTTTTTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGATTAATTAGTAAAGGAATCCTTTCAAGTCATCCCAAATATGGTTCCATTCCTAAACTCATATTTGCTTGTATCATGGGATACTTTGCTGGAAAGCTTTCTTATGTGAAAACGTGCCAAGAGAAGTTCAAGAATCTTGAGAATTCCCCTCTTGGAGAAGCTTTACGATCAGGACAGGCACGACGATCTTCACCACCTGGACACTACTCTCAAAAGTCAAAATATGACTCAAATGTGAGTGATCATTCATCTTTTGTGACATCACCAGCAGCAGACAACATGGAAAAAGAGATGTTTTCTCATTATGAGCCAGTTCCATTCAGTGCTTCTATGAATGAATCTACTCCCACTGGTATAACTGATCATATTGCGCAAGGTAGAAACTTCTCTTGAAATGAATTTCAGCATTTTATGGTCCAACGTATGTATAAACTTTATTTGATGACCTTTTCTGCTGGATATCACCTATATGTTCCACCATCAGTCTAAACTCAGCATGTTTGTTCATTTCTTTCTTCATTCATTTAACATTTTTTTTTCATTTACTATTTTTGAGGTCCATTAGGTATCAGGCATTCTGCTAGCTATGTTAGAAGTAAATATGAATAAGACTTGGTTCTTTTCTCTGAGAAACTCTCTGTCAGTAAATATAGAAATATAAGGATAAATTACTAGTATGTCCCATCAGTTAAATACTAACCGGGTTTAGCAGAATAGCAGAGAAGTGATAAGTGCCTCAGGGGGAGGCTTTAAAAAGTTTACATTTGTTAAGCTGATCTTAAAGGCTTTCAGCTCCTTTGCTTGTAATATGAGAAAAATACTAATTACCTGCCTTTCAAAACTGTTGTCAGGTGAGAAAATCCATGAGAAAATGCTCTGTGAAGTTTATGTAAACTCTAGCTTTGAAAATCACATAAGTAAGTGAACAATATCAACTTTGGATTAAGGCCTGGATTTGATTCATGATTGACATTTACTAGCTCTATGACTTTTGGCAAGTAACTAATTTGTGATCCCTTCAATTTCTTGATCTCTTGAATGCAGATGACAATACCTCTTTTAAAGAACTTTTGGAATGAGATGAAATAATCAGAGGTAACGCCTGGCAAGTAATAGGCTCTCAACAGACATTAGTTTCCTTCTTTTCTTCCATAAGTCTAATTTACAGTGAAAGGTGAGAAAGTATAGGTCTGCAATTTGTTACCTGAAATCCTAAAATCCAAAAAGCTTTGAAAACCGAAGTTTTTAAAAATAATTAAACAGGTGGTAAAGTCTGACCTAAACGCATTTCCAACCCTGACCTAAACTGACATAAGTTTAAATTCTGAGGAAGTCTGAATTTTGAAACATTTCTGACTCTTCAAGGATTTGGATAAGGGATTGTGGACCTCTATAGAGAATTCTTTGAAAATGCTTACTTTGAACCAAATACAATAAGCAAGCAATTAATGGGGAACAAACAGTGTTTAAAGGAACACTTTGATTTTTATTTCTTTTGTTTAAGTTGGGAGAGATTTGTGTGTGTGTGTG