Transcript asmbl_63511

Sequence
Transcript Sequence for observation asmbl_63511 of TGE0006885:
CTGAAACTCCAGCGGGTGAGGATTTACTAGGAACGCATCCGTAATCCGTAGCCATCCGTTCACGGACGCGGTGGCTCTTGATCCTGGGAGCCTCGATACTCTTCTAGTGGCCGAGTAGCAGCCAAAGAGAGGGACTAAGATGCCAGTATGAAGTTCAACCCCTTTGTGACTTCTGACCGGAGCAAGAACCGTAAAAGGCATTTCAATGCACCTTCCCACATTCGCAGGAAGATTATGTCTTCTCCTCTTTCCAAAGAGCTGAGACAGAAGTACAATGTTCGATCCATGCCTATAAGAAAAGATGATGAGGTTCAGGTTGTGCGAGGACACTACAAAGGGCAGCAAATTGGCAAAGTAGTCCAGGTTTACAGGAAGAAATACGTCATCTACATTGAACGAGTGCAGCGGGAGAAGGCTAATGGCACAACTGTTCATGTCGGCATTCACCCCAGCAAGGTGGTTATCACTAGACTAAAGCTGGACAAAGACCGCAAAAAGATCCTTGAACGTAAAGCCAAATCTCGCCAAGTAGGAAAGGAAAAGGGCAAATATAAGGAAGAAACAATTGAGAAGATGCAGGAATAAAGATTCAGCTCTGCCCCTCAACTCTTCATGTAATGGCTGGGATCCCAAGGATCTTGTTTTCCTAAGATTGTTGGAATGCCTGTGATCATACGAACTCTTCCCCTGGCCTCATCACCATCACATATCCTGGAGTTGTTCCAACAAAGGAATCTTGGTTTAGAT