Transcript asmbl_97159

Sequence
Transcript Sequence for observation asmbl_97159 of TGE0004565:
CCGCCGCTGCTGCTGCTGCTGCTGTCGCTGCCGGAATCGCCGCAGCTCCCAGCCTCGCGCGTCGCCGCTACCTTCTCGGACAGAAATTTTATGAATAAGCATCAGAAGCCAGTGCTAACAGGCCAGCGGTTCAAAACTCGGAAAAGGGATGAAAAAGAGAAATTCGAACCTACAGTCTTCAGGGATACACTTGTCCAGGGGCTTAATGAAGCTGGTGATGACCTTGAAGCTGTAGCCAAGTTTCTGGACTCTACAGGATCAAGATTAGATTATCGTCGCTATGCAGACACACTCTTCGATATCCTGGTGGCTGGCAGTATGCTTGCCCCTGGAGGGACACGCATAGATGATGGTGACAAGACCAAGATGACCAACCACTGTGTGTTTTCAGCAAATGAAGATCATGAAACCATCCGAAACTATGCTCAGGTCTTCAATAAACTCATCAGGAGATACAAGTATTTGGAAAAGGCATTTGAGGACGAAATGAAAAAGCTTCTCCTCTTCCTTAAAGCCTTTTCCGAAACAGAGCAGACCAAGCTGGCGATGCTGTCAGGCATCCTGCTGGGCAACGGCACCCTTCCTGCCGCCATCCTCACCAGTCTCTTCACCGACAGCTTAGTCAAAGAAGGCATTGCAGCCTCATTTGCTGTCAAGCTTTTTAAAGCATGGATGGCAGAAAAAGATGCCAACTCTGTTACCTCTTCTTTGAGAAAAGCCAACTTAGACAAGAGGCTGCTTGAACTCTTTCCAGTTAACAGACAGAGTGTGGATCATTTTGCTAAATACTTCACAGACGCAGGACTAAAGGAGCTTTCTGATTTCCTGCGAGTCCAGCAGCCCCTGGGCACCAGGAAGGAACTGCAGAAGGAGCTCCAGGAGGAGCGTCTTTCAGTGATGCCCGATCAAGGAGGTGGTGCTCTATGTGAAAGAAGAAATGAAGAGGAATGACCTTCCGGAAACAGCAGTGATTGGACTTCTGTGGACCTGTATCATGAATGCTGTTGAATGGAACAAGAAGGAGGAACTCGTGGCAGAGCAGGCCCTTAAGCACCTGAAGCAATACGCTCCCCTGCTGGCTGTGTTCAGCTCCCAAGGCCAGTCAGAGCTGATCCTTCTCCAGAAGGTTCAGGAATACTGTTACGACAACATCCATTTCATGAAAGCCTTTCAGAAGATCGTGGTTCTCTTTTACAAAGCCGATGTGCTGAGTGAAGAAGCAATTTTGAAATGGTACAAAGAAGCACACGTGGCCAAAGGCAAAAGTGTTTTTCTTGACCAGATGAAGAAATTTGTTGAGTGGTTACAAAATGCAGAAGAAGAATCCGAATCGGAAGGTGAGGAAAATTAGATGACTCGAGAAGCACAATACCTAGGGTTACTACACAATACTTTGATTGGGAATGCTGAACCATTCGAGAAGAGAAACTTGGCTTCTGTTTTCACAAAGGATTAAAAATAGGATAGGGTTCCCTTGTGCAGAAGGGGAAAAGTGGTTTTGTTTTCATTTTGTTTTTAAATGGAGCCCTGAGGCATCAGCTATTACACTTGGGACTCTACCTCTCACTCACTGTATGCTAACTTAAAGCCATTCAACAAGGAGTCAAGTAGGAATCTGAAAGTAAATACTCAACGGACTCCTCTTTTTTAGCTGTATTTTTCAGGTACTGTGTGGTGAATGCCCCACTGGTGTCTATTACAGGGCCACTTTGGTAGTTGTGTATCTGCTCGTGTATGTGATTTGACAAACCAGTTTTTTTAAATAAATGGCTTTATAAAAA