Transcript asmbl_97041

Sequence
Transcript Sequence for observation asmbl_97041 of TGE0004556:
GGAAGATGTTGGCTATTTGGCGATAGAAGTGGTGAAAACTGACCTCACACCGGTAGACGAGCACTACGGGACCTGATCCTCTTGCTGCACGGGCAGCCGGCCCCCACTGAGCATGTTGGGAAGCCATGGAGTCCACTGGAAAACACTAGTCTGATCTTGGAAGTGGCTGATTGTGGCAGGATGTGTCGACGATGATGATGGCCAGAAAGCAAGATGTCCGTGTTCCCACCTACAACATCAGCGTGGTGGGGCTGTCTGGGACCGAGAAGGAGAAGGGCCAGTGCGGCATCGGGAAGTCCTGTCTGTGCAACCGCTTCGTGCGCCCGAGCGCCGACGAGTTCCACTTGGACCACACCTCTGTCCTCAGCACCAGTGACTTTGGCGGGCGGGTGGTCAATAATGACCACTTCCTCTACTGGGGAGAAGTCAGCCGATCCCTGGAGGATTGCGTGGAATGTAAGATGCACATCGTGGAGCAGACTGAGTTCATTGACGATCAGACCTTTCAGCCGCATCGAAGCACGGCCCTGCAGCCCTACATCAAGAGAGCTGCCGCGACCAAGCTCGCGTCGGCTGAGAAACTCATGTACTTTTGCACTGACCAGCTGGGGCTGGAGCAGGACTTTGAGCAGAAACAAATGCCAGATGGAAAGCTGCTGATCGATGGTTTTCTTCTCGGCATTGACGTTAGCAGGGGCATGAATAGGAACTTTGATGACCAGCTCAAGTTTGTCTCAAATCTCTACAATCAGCTTGCAAAAACAAAAAAGCCCATCGTGGTGGTCCTGACTAAGTGTGATGAGGGCGTCGAGCGGTACATTAGAGATGCACATACTTTTGCCTTAAGCAAAAAGAACCTCCAGGTTGTGGAGACCTCAGCAAGATCCAACGTCAACGTGGACTTGGCTTTCAGCACCTTAGTGCAACTCATTGATAAAAGTCGGGGAAAGACGAAAATCATCCCTTACTTTGAAGCTCTCAAGCAGCAGAGTCAGCAGATAGCTACGGCAAAAGACAAGTACGAGTGGCTGGTGAGTCGCATTGTGAAAAACCACAACGAGAACTGGCTGAGTGTCAGCCGAAAGATGCAGGCCTCCCCTGAGTACCAGGACTACGTCTACCTGGAAGGGACCCAGAAAGCCAAGAAGCTGTTTCTCCAGCACATCCACCGCCTCAAACACGAGCACATCGAGCGCAGGAGGAAGCTGTACCTGGCAGCTCTGCCGTTGGCTTTCGAAGCTCTTATACCCAATCTGGATGAAATAGACCACCTGAGCTGCGGAAAAGCCAAAAAGCTCTTGGAGACCAAGCCGGAGTTCCTGAAGTGGTTCGTCGTGCTCGAGGAGACCCCGTGGGATGCCACCAGCCACATCGACAACATGGACAACGAGCGGATTCCCTTCGACTTGATGGACACTGTCCCCGCAGAGCAGCTGTATGAGGCCCACTTAGAGAAGCTGCGGAACGAGAGGAAAAGAGCTGAGATGAGGAGGGCGTTTAAAGAAAACCTGGAGACCTCGCCTTTCATAACTCCTGGCAAGCCCTGGGAAGAGGCCCGCAGTTTCATCATGAATGAAGATTTCTACCAGTGGCTGGAAGAATCTGTATACATGGATATCTATGGCAAACACCAAAAGCAAATTATAGACAGGGCAAAGGAGGAGTTTCAGGAGCTGCTTTTGGAATATTCAGAATTGTTCTATGAGCTGGAGCTGGACGCTAAGCCCAGCAAGGAGAAGATGGGTGTTATTCAGGATGTCCTGGGGGAAGAACAGCGGTTTAAAGCGCTGCAGAAGCTCCAGGCGGAGCGCGATGCCCTCATCCTGAAGCACATCCACTTCGTGTACCACCCAACAAAGGAGACGTGCCCCAGCTGCCCAGCCTGCGTGGACGCTAAGATCGAGCACTTGGTTAGTTCCCGGTTTATCCGACCATCTGACCGGAATCAGAAAAATTCACTCTCTGACCCCAACATCGATAGAATCAACTTGGTTATCCTGGGCAAAGATGGCCTTGCCCGAGAGTTGGCCAATGAGATTCGAGCTCTTTGTACAAACGATGACAAGTACGTGATAGATGGTAAAATGTATGAGCTTTCCCTGAGGCCGATAGAAGGGAACGTCAGGCTTCCCGTGAACTCTTTCCAGACGCCCACGTTTCAGCCCCACGGATGTCTCTGCCTCTACAATTCGAAGGAGTCGCTGTCCTACGTGGTGGAGAGCATCGAGAAGAGTAGAGAGTCCACACTCGGCAGGCGAGATAATCACTTAGTCCATCTCCCCCTGACGCTAATTCTGGTGAACAAGAGAGGAGACACCAGCGGAGAGACGCTGCATAGCTTAATCCAGCAAGGCCAGCAGATCGCCAGCAAACTCCAGTGTGTCTTCCTGGACCCTGCCTCTGCCGGCATCGGTTATGGACGCAACATTAACGAAAAGCAGATCAGTCAAGTGTTGAAAGGACTCCTGGACTCTAAGCGTAACTTAAACCTGGTCAGTTCTACCGCTAGCATCAAAGATCTGGCTGACGTTGACCTGCGAATTGTCATGTGTCTGATGTGCGGAGACCCTTTTAGTGCAGACGACATCCTCTTTCCCGTCCTTCAGTCCCAAACCTGTAAATCTTCCCATTGCGGAAGCAACAACTCTGTTTTACTTGAACTACCAATCGGGCTACACAAGAAGCGCATTGAACTGTCTATTCTTTCATACCATTCCTCGTTTAGCATCAGAAAAAGCCGGTTGGTCCATGGGTACATTGTTTTTTATTCAGCCAAACGTAAGGCCTCCTTGGCTATGTTACGTGCCTTTCTTTGTGAAGTGCAGGATATTGTCCCCATTCAGCTGGTCGCACTCACTGACGGCGCTGTAGATGTCCTGGACAATGACTTAAGTCGGGAGCAGCTGACCGAGGGGGAGGAGATCGCTCAAGAGATAGATGGCAGGTTCACAAGCATCCCCTGCAGCCAAGCCCAGCACAAACTCGAGATCTTCCACCCATTTTTTAAGGATGTGGTGGAGAAAAAGAACATAATCGAGGCGACGCACATGTACGATAACGCTGCCGAGGCCTGCAGCACCACGGAGGAGGTGTTCAACTCCCCCCGGGCGGGCTCTCCGCTCTGCAACTCCAACCTGCAGGATTCGGAAGAGGACATCGAGCCCCCTTCCTACAGCCTGTTTCGAGAAGACACGTCGCTGCCCTCTCTGTCCAAAGACCATTCCAAGCTGTGTATGGAGCTGGAGGGGAACGATGGGCTGTCTTTCATCATGAGCAATTTTGAGAGTAAACTCAACAACAAAGTACCTCCGCCAGTCAAACCAAAGCCTCCTCTCCATTTTGATATTACAAAGGGGGATCTGTCTTACTTAGATCAAGGCCACAGAGATGGGCAGAGGAAGTCTGTGTCTTCTAGTACCTGGCTACCTCCGGACGCGTTCGATCCTTCCGATTACGCCGAACCCATGGATGCAGTGGCCAAGCCGAGAAATGAGGAAGAAAACATATACTCGGTGCCCCACGACAGCACCCAAGGCAAGATCATCACCATCCGGAACATCAACAAAGCCCAGTCCAACGGCAGTGGGAACGGTTCCGACAGTGAGATGGACACCAGCTCCCTAGAGCGAGGCCGCAAGGTATCCATCGTGAGCAAGCCAGTGCTGTACAGGACGAGATGCAGCCGGCTGGGGAGGTTCGCTAGCTACCGAACCAGCTTCAGCGTGGGGAGCGATGATGAGCTGGGGCCCATCCGGAAGAAAGAGGAGGATCAGGCGTCCCAAGGTTATAAAGGGGACAATGCCGTCATCCCGTATGAGACAGACGAAGACCCGAGGAGGAGGAACATCCTGCGCAGTCTGCGAAGGAACACCAAGAAACCAAAGCCCAAACCCCGGCCGTCCATCACGAAGGCAACCTGGGAGAGTAACTATTTTGGGGTCCCCTTAACGACCGTCGTGACTCCAGAGAAGCCAATCCCTATTTTTATTGAGAGGTGTATTGAGTACATTGAAGCCACAGGACTGAGCACCGAAGGCATCTACCGCGTCAGCGGGAACAAGTCGGAGATGGAGAGCCTGCAGAGGCAGTTCGATCAAGACCACAACCTGGACCTGGCGGAGAAGGACTTCACAGTGAACACGGTGGCTGGGGCCATGAAGAGCTTTTTCTCGGAACTGCCTGACCCCCTGGTCCCGTACAGCATGCAGACTGACCTGGTGGAGGCTCACAAAATCAACGACCGAGAGCAGAAGTTGCACGCCCTTAAGGAAGTACTCAAGAAATTTCCGAAGGAAAACCACGAAGTCTTCAAATATGTCATCTCGCACCTGAACAAAGTCAGCCACAACAACAAGGTGAACCTCATGACCAGTGAGAACCTCTCCATCTGCTTCTGGCCCACCCTGATGCGGCCGGACTTCAGCACCATGGACGCGCTCACGGCCACGCGCACCTACCAGACGATCATTGAGCTCTTCATCCAGCAGTGCCCCTTCTTCTTCTACAACCGGCCCATCAGCGAGCCCCCCGGCGCCACGCCCAGCTCCCCCTCCGCCCTGGCCTCCAGCGTGCCCTTCCTCACCTCCACACCGGTCACCGGTCAGCCGTCGCCCCCACAGTCGCCTCCACCCACCCCTCAGTCCCCGATGCAGCCCCTGCTCCCCTCCCAGCTTCAAGCCGAGCACACGCTGTGAGTCACCAAGGCCTGGGGCAAAAAGAGGCTCGATTTTCTCAGTCGGGGTGGCGTTTGGTCTTGAACACAACCAGGTCCACTGGGGCAGGGGTGGGGAGGCTGTCCCCTCCCCCTCTGTCACCTTCTCAAGATCTCAGCTGCAGCACCAGCCAGCGTCCACCATAGGCTGGGCCCGCGGCGCCCCGAGCCCAGCGCCGCAGACCTGGGGCTGACTGCGGGCAGCGGCTGGGGGCCCTGCCCTTGGACACGGACCCCTTCGAAGACTGACTGGCCAGGCGGCGGCCCCGGTGGCCGTCCACATGCTCGCTGTTCCGGGACTGCCTGCCCACGCACACCAGCTTCGGCGTCACCCACTGCCTGACAGAGCCCTGGCCTTTGCCAGGGGGAGGAGGTGGTTTTGATTCGGGCCACCCCTGGCAACCTCCGAGGAGACACTTCTCATCTGGCTCACCTGTCTCCCTACCTTCCACATCTGTTCCCACCCCCGTCGGCGGGGCGCCTGTCCAGCAGCCTCCTGGGGAACAGAGGCCACGGCGCTGCCGCCCCAAGGCACAGTGCCGAGGGCGTCTGCCCGGCCGCCCAGAACAGCTGGAGGGAGCTTTGTGCCTGGACCGAGAGAGTGTGACTCGTCCCTCCAGCCCCCGTGCTCCCTGTCCGCTGCATAGGCTTCGGGGACAGTTCCCTTCATGACAGAGGGACACTGGGAGAAAAGGAGGAAAACCTGTCCAGTAACTTGGAAAAACAAAAAGGAAGAAACTACAGACCTCAAGACTCAGCTCCCCCGCTTCTCAGGCCGACGGGCGCAAGGGGGCCCTGGTCTTTGTGACAGCAAAACCAGGAGGCCTGGCGGGCGGCTGCCTGAGAACTAGTTGGGGGTCCCACTCACGTCCTGTTATCAGGTCTGTGTTCCCCAAGAAGAGACGATTCGAGCCCTCGGTGGGTGGAGCTGGGGATTCGAGCAGACCAGCCTGGCACCTGGTCTGCCCTGGAACACTACAGGCTGTGGGGACACTGGGGGGAGGAGGACTGGAGTGGGGCCAGCTCAGGGCGCACTGGGGTTTCGTTTAGTGTGCTTGGTGTTGAAGCGGAATCGTTTCATTCTGGGGCACACTGTGCCACCAGCAGGGTGTGTGCGGGAAGAGGGCGGGGTAGGGAACTGAAGCACTGTGTCCTGCTGGTGTCCGCAGGGGCCATCCTTCATGCTCCCCAGGCCAGGAGATCCCAGAGGAGCCACATGCACAGAGGCCACCAGAGTCACAACACCTGCCTGTCTCACCCCACCCCCCTCCTGTGGCCTTGCCCACCCTTTCTGAGAAATGGCCTCCCCTCAGCTTCCTGGCCTTTCCACTGGCCCCTGGGAGAACCCTTCCCACGCCCCAGTACACACAGCAACCTGCTAAGGCTGCTACAGACCTTGGCTGCCCCCTACCCCTGGTGGCCGGGCTGTGGCCGCTGCAGTGGAGAAGCCTGACACTACGGTGCCCAGGGTGCAGGGTGTGGGGTGGAGGGCCCGCCCACCACACTGACCTCTGGGTCTCTGCACTTTAAGAAGTAGCACCTGGGTGTGTTTGAGGATGCCCTGGTCACCTCAGCTGGGTGGCCTGACAAATTAAGAGATGCCCCGAGGACTGTCCAGGTACCCCTAGCCCCAGACGCTGCCGGCTGGCTGTAGAGAGTGGGGCAGCCCTCGGCTCACGGGCTCCTTCCTCTGGATAAGCTGGATCCTTACCGTTCCTAGTTCGCGTACGGCAAAATAAGGTGCTTGGAAAAACTAAATTATCCCTGCAAGTTTTACCCTCCTTTTCAGGAACCCAAGTCAAAAAACACACCCGAGGTACATGACCGTTTTATGTAAACGTTGGGTGACGAGCGTTTCTCTGGTGGAGCTGTGCTTGATGGTTTAGGTCAGGGTGGGCTGCAGGGTGACGTTCTTGTTCAGTTTTGACAGAGGTTGGCAGACCCCCAGGCAGGAGAGGAAGTCGGTCCACTGAATTAATTTGTCCCTCGTTCTCACCTGCTTCGAGGCACTGCGTTTGAGTTGAAAGGGTGCCATGGGGGTGACCTGGGGCCACTGTCCTGGTGCGAACTGAAATAGCAGTATCCCAGTTCCCTCCCGCTGCCCAGGCTGCACTGCCACCCCCTCGGTGCTGGCGCCCTGGCCACAGCCCCACCCCGCTTGCAGCCTGGGCTCTGCACCAGGAGCTCAGAAGCCCCCAACAGGCCTGCCTGCCCACGGCACCCCACCCTGAGATGCAGCGTGTACGCGGCAGGGGGTTCTGGGCGTGTGGGGAGGAGCAGCAGTGCTCGGCGTCCTCCCCAGATAGAGGTTGCCTCCGGTCCCGCAGCGCACCCTGGCGGCCAGCTGGAGCAGCCATGGGCCCCCCTCACCTTCCCGTGTCCTGCCAAGGTTTTCGAGGTGCAGGCGGGGGGACCAGCAGCTCCCGTCCAGCCAGAGCTGCAGTGGGCAGGCGGCTTCGGGGTTCCTCTCGTTTCTGCTGCTTCCTCACGGACTCCGCTGCTGCTTTCAGCTGGCCCAGGCTAGGGGACGTGTCTTGGTCATTCTGAGTTGGCATCACCACTGGTAGTGCTGGGCCCCAGGTGTCCGCTTCCACTCGGGGGTCGGCGTTCAGACGAAGTGGGCGCTTGGGTGGAGGGCCACGAGAGCTGGGGCTCGCGTGGGACGCTTCCTTAAACACATGCTCCCCACGGCTCGAAGCTAAGAGCGGAGCGAGCACGAGCCGGCCTTGGCCAGGGGGCCGGCAGGGCGTGGCGGGCAGGGCTCTCCCCGTCTGGTGGTCTGTCTGGGTCCACGAGAGAGTAGGTGCCACGACAGCCATTGGCTGTAAGCTGAAGGCCAGTCCTGCCCTGTGGCACTGGTGCCGTGGAGGGCAGGGGCTGGGGTGGCTCGCAGGGTCGCCCTGAACCCCTGGCCGTGTCGGGCGTCACAGCATCCTGACGTGAGGGGCACGGAGAGAACTGGGCGGCACGGTCTCTGTGAGCCCCACCCCCGCTGCCGCCGTGGTTCCTCCTGTGTGGCAGGAAGTCTGCCGCCGGGTGATTCTTCCAGAGCAGGCGAAGTGAGCCCTGGTGGCCATGGTGGTTCCTCGCAGCAGCGCGCTGCCCAGAGGGCTCAGGAGCGTGCGCCTTCCCCGTCCGTGTTCCTGGCGCGTGGGGGGTGAACAAGGGTGCCCCAGCCTCGGCCCTGAGATTTGAAAACGAGCTGCAGCGTTAGTGATCTGAAGTCGCCTCCCGCACCCCATCCCTCCCGTGAGAATACTGCTTTGAGGGGTCTGCTAGAGCAGGGGTCCCCAACCCCCAAACTGTGGACCGGTACCGGTCTGTGTCCTGGTAGGAACTGGGCCGCCCAGCAGGAGGGGAGCGGCGGACGGGCGAGCGAGTCGTCGTCCGTGTCCGCAGCTGCATCCCAGCGCCAGCATCGCCGCCTCAGCTCCCTCCCATCAGCGAGCATTGGATTCTCATGCAAGCACTGGTCCCTGATGCCACAAAGGTGAGGACCACTGCACTAGAAAAAGAAGTGGGCAGTGGCCGGGAAGTGTCGGCCCCCAGCCGCCGAGGGCTCTGGTCAGCCGGCCACTGCGTTTCCCAGGGGAAGCAGTGCCAGGACTTGGGCGAGTTGCTGGGGACCAGCTTCCTGTGCTCCACCTTCCTCGTGGGTCATGGGTGTAGCATGCCCTGGGGCACGGGAACGGGCCTGAAGGGCAAAGCCTTTGCCTCGCCTCCGGAGACAGGCACAGCGCTCATTCTGCAGACGGGGCCGTCACCCTCACTCCTATCGCTTGGCAGGTTCAAGCCACTCTTTTGCACTTAGGTGGAAGGACAGACTGAGTCACGTGTGCCAGAAACCTAAGTCCGGTCTGGGACTGTGCTGGGGACGGCAGCAGGGAGGGCGTGGTGTGCAGGGAAAGGCCGTTCTCTCCCAAGGTCTGGGCGTCCCCCGGGCTGTGCCTGTGTCGCTGTCTTAGATGGGAAGGACCCTTCCCTCGGGGAGCCGCCCACCTGTGGCCCCCCGGGGGTCAGAGGTGGCCACCCCTCTGCTGCCAACGCCGCCAGCCCACACGGCCGTGAGGTCACACTGTCAGTGTCGTGAGACGGGGCATAAGTTATTGTTTGCATAAAAAAGAATCATGTTCCCTGTGTACATTACAAAAAAGGAAATGTCTGAACCGTATGGGAATAAAACTTGTTTGAAAATTTGGAATAGTGCTGCTGCCAGCTTATTTTTCTGGTACTTGTATTTTCACATGTTAAATGATCTTTATATATGTTGAATTAACAAATATTTTGAGTTTCCTGAGGAAAAAAAAAACATTAATGGTATTGAAATGTGTTAGTAGTCTGGCCACGTGCCCAAAATTCTGTTTTGCAGCAAAAGTGGAGAACTGTTTGTGAAGAAAGTTAACAGTTGCTTCTTTGTGTTTTAGGGGCTTAACCAGGACACGCTCTAGGTGGTGGTAGGAATGTTTGCTTAATTTCCAGACTCTTTTTCTTTGAACATGTCGTGGGTACCTTGAGGCTCCAACCTGGCTAGTGCATGGTCAGCCATCAACTAAGGCTGAGGCATCTCTGACCGAGGTGTTCTACGTTTGGTTTTGTTTTTTAAAATCATGTATTTGCTACAAAGTATTGTACTTGTCTCAATGGGAATGGTGTAAAAAACTGAAAAGGCCTTATGTGATATGTATCATAGTCAATAAATCCGTCTTGT