Transcript asmbl_95615

Sequence
Transcript Sequence for observation asmbl_95615 of TGE0001056:
GGTCCCTAAAGGAAAAGGGGCGGAGTCTACCCCTAAAGTGAGGAGTGGATTGGCTTCTCGGAGACCTCGCCCCCGAAGGGAGGGCCGGCGGGCATTTGAAAATGGCTTGTCCTCTCCCTCCTGCAACCTGTGCCGTTCTACGACGAAATGTTTTGAGTCGGACCAGCTTTCTTTTTCTCTCCGTTGCTGTGAACATCTGCCCCGTACGGTCCTGAATGGTCGTGAACCACTTAAGCAAGGCTTTTACGCCAGCGTGCACAGGGCTGACCGGGGTCGCTATAGCAACAGGCCACGCCCTCCCCGCTAGTTGGATTTGCGCAGGCGCCTACGGAAGTGAGCAGAAGGAAGCGGAAGTCCCGCCTCTCGCGCTCTCTCTTCAGAGGCAGAAGCAACGCGGAGGGAACGCGAGCATTTCGAGAACGCAGCCGCTACCACCATGAGCCTCCTCAACAAGCCCAAGAGTGAGATGACCCCGGAGGAGCTGCAGAAGCGGGAAGAGGAGGAGTTTAACACGGGTCCACTCTCTGTGCTCACGCAGTCGGTCAAGAACAACACCCAGGTGCTCATCAACTGTCGCAACAACAAGAAACTCCTGGGCCGTGTGAAGGCCTTTGACAGGCACTGCAACATGGTGCTGGAGAATGTGAAGGAGATGTGGACCGAGGTCCCCAAGAGTGGCAAGGGCAAGAAGAAGTCCAAGCCCGTCAACAAGGACCGCTACATCTCCAAGATGTTCCTGCGCGGGGACTCGGTCATCGTGGTCCTGCGGAACCCGCTCATCGCCGGCAAGTAGGGGCGTCCTCCCTGCGGCGGAGCGCGGCCCCGAGCTGTGGGGGCCTTGCCTGTGAGATGGGAATAAAAGTCCTGTGTA