Transcript asmbl_95160

Sequence
Transcript Sequence for observation asmbl_95160 of TGE0004542:
GGAAGATCTGCCCTGCTGGCGCGCAGCCTCCCCGCGAAGCCCCCTCTGGCCCCGGGAGTGGCGGCTCTCAAATTACAACAAAAGGAGCTGGGGGCCGGGCCTGTGCGGTGGCCGCCTTCAGGGAAGGGGGTGGGTCCGGGGAGGGGTTTGCCGTCTGACTCGCGTTAAAAGTACCGGGAAAAGGGTAAAGGAGCGACTCCAGCCCGCCGCTTCCTCAACTTGGGGCTCGCTGTCTCCGGCTCCGCTCGGGTAAGGGGCTCTGCAGCGACGTGCGCGGAGAGGGGCCACCGTGGGAAACTGGCCCCAGAAGAGCCAGGGCGGACTCCTGCTTCCAAGAGTCTCCGGCTTGTCGCTCCTCACGGCCCAGTGCCCCCTCCATCAGGTCCTCCAGCCAGAGGACAGGCATGGCGAGGCCGGGAGGCTCCTGCCTTTGCAGCTGTTTGGCTGTGCTCTGCCTCCTCCCCTCGCTGAGCCTGGCGCAGTACGAGAGCTGGCCCCACTACCCCGAGTACTTCCAGCAGCCGGCTCCCGAGTACCACCGGCCTCAGGTGCCCTCCGACGTCACCAAAATCCAGCTGCGCCTGGCGGGTCAGAAGAGGAAGCACAGCGAGGGGCGGGTGGAGGTGTACTACAACGGCGAGTGGGGCACCGTGTGCGACGACGACTTCTCCATCCACGCGGCGCACGTCGTCTGCCGGGAGCTGGGATACGTGGAGGCCAAGTCCTGGACCGCCAGCTCCTCCTATGGCAAGGGGGAAGGCCCCATCTGGTTGGACAATATCTACTGCACTGGCAAAGAGGCGACCCTTGCAGCCTGCTCCTCCAATGGCTGGGGTGTCACCGACTGCAAGCACACAGAAGACGTGGGTGTGGTGTGCAGTGACAAAAGGATTCCTGGGTTCAAATTCGACAATTCCTTGATCAACCACATAGAGAACCTGAACATCCAGGTGGAAGACATCCGCATCCGAGCCATCCTCTCCGCCTACCGAAAGCGCACCCCTGTGACGGAGGGCTACGTGGAAGTGAAGGACGGCAGGGCCTGGAAGCAGATCTGCGACAAGCACTGGACGGCCAAGAATTCCCGTGTGGTCTGCGGCATGTTTGGCTTCCCTGGGGTGAAGACGTACAACACCAAAGTGTACAAAATGTTTGCTGCCCGGAAGAAGCAGCGCTACTGGAGGTTCTCCATGGACTGCACGGGCACAGAGGCCCACGTCTCCAGCTGCAAGCTGGGCCCTCGGGTGTCCCGGGACCCCGTGAAGAACATCACCTGTGAGAATGGGCTGCCGGCTGTGGTGAGCTGTGTGCCTGGCCAGGTCTTCAGCCCTGATGGACCCTCAAGATTCCGGAAAGCTTACAAGCCAGAGCAACCCCTGGTGCGGTTGAGAGGTGGTGCCAACGTCGGGGAGGGCCGCGTGGAGGTACTCAAGAATGGAGAATGGGGTACCATCTGTGACGACAAGTGGGACCTGGTGTCTGCCAGCGTGGTCTGCAGAGAGCTGGGCTTTGGGAGTGCCAAAGAAGCCATCACTGGCTCCCAGCTGGGGCAAGGGATAGGACCCATCCATCTCAATGAAATTGAGTGCACGGGGAATGAAAAGTCCATCATAGACTGCAAATTCAATGCTGAGTCTCAGGGCTGCAACCATGAGGAAGATGCTGGTGTGAGATGTAATATCCCCGCCATGGGCTTCCAGAAGAAGCTGCGCCTGAACGGGGGCCGAAACCCCTACGAGGGCCGGGTGGAGGTGCTGGTGGAGAGGAACGGGTCCCTCATATGGGGGACGGTGTGTGGCGAGAACTGGGGCATTGTGGAGGCCATGGTGGTCTGCCGGCAGCTGGGCCTGGGGTTCGCCAGCAGCGCTTTCCAGGAGACCTGGTATTGGCACGAAAACATCAATGCCAATAAAGTGGCCATGAGCGGAGTGAAGTGCTCTGGAACGGAGCTGTCCCTGGAACACTGTCGCCATGACGAGGATGTGGCTTGCCCCCAGGGCGGAATGCAGTACGGAGCTGGAGTCGCCTGCTCAGAAACCGCCCCTGACCTGGTCCTCAATGCGGAGATCGTCCAGCAGAGCACCTACCTGGAGGACCGACCCATGTTCATGCTGCAGTGCGCCATGGAGGAGAACTGCCTCTCGGCCTCGGCCGCCCAGACCAACCCCACCTCAGGCTACCGGCGGCTGCTTCGCTTCTCCTCCCAGATCCACAACAATGGCCAGTCCGACTTCCGGCCCAAGAACGGCCGCCATGCGTGGATCTGGCATGACTGCCACAGGCACTACCACAGCATGGAAGTGTTCACCCACTATGACCTCTTGAACCTCAATGGCACCAAGGTGGCAGAGGGCCACAAAGCCAGCTTCTGCTTGGAGGACACAGAATGTGAAGGAGATAGCCAGAAGAGCTACGAGTGTGCCAACTTTGGTGAGCAGGGCATCACCATGGGCTGCTGGGACGTGTACCGCCATGACATCGACTGCCAGTGGGTGGACATCACAGATGTGCCTCCCGGAGACTACTTGTTCCAGGTTGTCATCAACCCCAACTATGAGGTTGCAGAATCTGACTACACCAACAACATCATGAAATGCAGGACCCGCTACGACGGCCACCGCATCTGGATGTACAACTGTCACATAGGTGGTTCCTTCAGTGAAGAGACAGAAAAGAAGTTTGAACACTTCAGTGGACTCATAAATAACCAGCTCTCTACGCGGTAAGGCAGCCTACATGGTCACGTGGTCACCTCCTGCCTTTGGGCCACAGCGCATCTTCCCCAACAACTGCAGTCCGACGGACGATCACCACACTCCCCCTCGCCTAGCCCGGCCCCGCCCCATCTGGATACCCTGCGGCCACATCTCAGCTCAAGAGGAATGGGTGTTCCTGACATTTGCTGGGGGCTGCTGCCTGAGCCTGGGAAGGTGTCTGGGAGTGGGCCTTGTCCGCAGGGCTGTGGGAGCAGTGCCACGGGCCATCTTGTCCGGGACCCCAGGCACACAGGTTGTCATCAGCTTGTCCCATCCAAACCAGTCACACCTGCCCCACACCCCACCCCATCCCCAGTCTGACACCACCCCCATCAGCTCACCACAGATAATATGGGGCCATTCTCTCCTCAAATTCCATGTCGGCAAAGCCAGTTTATCGCCCGAGGTGGTCAGGCTGAATCCCATTTCTCCTCCTCTTGGGTCATCTGCAACCAACTTGAACGTCTAGAGCTCTCTTCCAGTTAAACGAACTGCCTGTCCTCTCCTCTCTCTGTTCACGTATATAAAAAATGCTGCCACATTTTCTGATGAAGTGAGCTCAGAGCTGGTACTTCTCCCCTACCCTCAACTCTACATCCTATTTTTCAAGATACCATTATTATATTTTCACGAACTTTGAAACACAAATTAATTTAGTGGCATTTAATATTGGGCATCTGGGCCTTTGGAAGGAAAAACCTGCCCACCTGTGTAAGTGACTCATGGTTCTGTTGTTCTGATTCTGTGGGTAACTGATTCAACGGTGCTATAACCAGGGTCCTGGGTGACAAGGACACTCACCAAACGCCATGTGTCATCACAGACACTTACACATACTTGAAACTTGGAATAAAAGATTTATGATTTG