Transcript asmbl_92900

Sequence
Transcript Sequence for observation asmbl_92900 of TGE0004512:
CGGAACCATCCCTAGCGCGAGATAGGGAGCACCGCTGAGTGGCTAGCGGGAAGCTACTGAGAGGCGTGAGATTCCGCGCCGGGAAAGGACACTGCTCGGGGCTGAGATCCGGCAGGCCCCGGGCTTCCGATCCGCACCTGGCGAGCCCGGGTCAATTGCCGGGGTTCCTACACAGGGCAAGTTCTCCGGAGCCGGGTGGGGAGGCTCGCGGAGCGCGGGGCGCGTGGCGCCTCCTCGGGGCAGCCCGCAGGGTGGCCTCGGGCGCCTCCGCCAGCCGCTGCTGCTGCCTTATAAGGCGGGGGCCGGGCCGGGCCGGGGGAGGGGCTGCGTCCGCCGGGCCTCCTACCAGGCTATCCTAGCGGTGCCGGGCGGGTCAGAGAGCGCAGCGCGGCGGCAGCAGGAGCCGAGTAGCGTGCAGAGCCGGTCATGGGCAAGTCAGCTTCCAAGCAGTTTAACAGTGAGGTCCTGAAGGCCCACAACGAGTACCGGCAGCAGCATGGCGTTCCTCCACTGAAGCTCTGCAAGAAGCTCAACCAGGAGGCCCAGCAGTATTCGGAGGCCCTGGCCAGCACGAGGATCCTCAAGCACAGCCCAGAGTCCAGTCGTGGCCAGTGCGGAGAGAACCTAGCTTGGGCATCCTACGATCAGACAGGAAAGGAGGTGGCTGATAGATGGTACAGTGAAATCAAGAACTACAACTTCCAGCAGCCTGGCTTCAACTCTGGGACTGGACACTTCACGGCCATGGTGTGGAAGAACACAAAGAAGATGGGAGTGGGGAAGGCATCTGCAAGTGATGGGTCCTCCTTTGTGGTGGCCAGATACTTCCCAGCAGGGAATGTTGTTAACCAGGGCTTCTTTGAAGAAAATGTGCTGCCTCCAAAGAAATAACTTGTCAAACATAATGGGAAGGTGGCAGACTTAAGAACGTGGTATGAAGTACCTAGAAGAACATTAGCTGTGTGTTTGTCCTTGTGGGTGTACATGCTTGTGTGTGATGCATGTGTGCATCTCTTGCACACATACTCGGATATACAGTTCTGTATGAACTCATTCTTGTCAAAAGAATGAGCATATGAAGGCTTTACTCTGATAGTTACCTAGACCACAATTATTTGGACTTTGGGGGCAAAATCAATTTTTAAACTTTTTTTTTCATTTTTTTAAGCAAACTACTTTTGTACGTTTCTTACTTTTAATATCCATCCCTGGACTTTTTATATTCCTCATGTTTGTGATACTGAGAACTGAAGTTCATTTTTTGTGATCTTCATACATTGTAATCTACTTGTGGTAGATATTTAAAAATATTAAACCTTCATTTAAATGTGACATAAAATGCAGCTTTAAACACATAAATATAAAGCAGCTTCCATGAGAAAACTGGTGTAGGCAGGAGTTCCATCTCACAGAATTACTGAGATTTCTCAGTTGTAAGACATGATGTCATCTGCATGCCTCCTGGAATTCTCTAATGGGATTGCCAAAGAACAAATGGAGAAGAAAACTTTACTTCTTTGCATTTTTCTACCTTTAAATAGCAAAGTACCACTACCACAACTACCCCTTGCCCCCTCCCCCATCTTTTTTCTTAAAATTCTCTGGCATTTCAGGGCTCAATATGTTTCCTGATTTCTGGAGAACTGGGCAAGGCCTGAAATTCACCCCTCCCCCACCTCTGCTGGGCGGCCCAGGACCCGTTCTGGGAGAGAGCCCCTCATACTGCCTGGGCTCTCAGCCAAGCGGCCTTGGATGGATGAAGTCAGTGAGTGTGGGGGAGAGGGTGAGCTCACTCAGGGCCCCCAGAGGAAGCTCTCCAGCCTCTGCCCTCCCCCTGACACACAGGGCGGGAGCCCGGGCTATTCGTGGCAGCTGTGGCTGCAGCTGTGCTGCTGTACCCTCCCAGAATGTGTGACAGGCCCAAATGTTCCTGGGAGATATCCCATGCGGGGCTTAGAGTCGCTAATTTGGTTCTGTGTTTTGCCTCAAACTGCACAAAGCTCCCCTAAACAACAATTTCGTATGGTGGGGGAGGGACCAATCCAGAGGCCAAGCTGAGTGTCCCTGAAACCATGGCATCTCCAGGTGGTAAGATAGCAGGAGCAGGAGTTAGGGAGTTACCTGCTTAA