Transcript asmbl_92170

Sequence
Transcript Sequence for observation asmbl_92170 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTAGCTGTGTTTGAGATGAAAATCTGGGGCCAGAGCGGGGCACAGAGGGGAACGGAGGCTGTTGGCCTGGCTTGCTTCAGCAGCTGACCTGGGGAGGCCACAGCGTGTGTGTTCATGGCGCTCGGGCTTGGCTGAGCAAGTCTCTGGGGATGTGGGTGGACAGGTGCTTGCTCAGCCATTCAGAGGCCAACCAAGTAGACCCCCTCGGCAAGGGGTCATGTGAGGAGGCTGAGTACCCGTGTTTCACTCCCAAAATCAAGTGCAGAGAGATGAGTACACTTCTCTTGACCCTGTTACTGTACGAAACAGTGCTGTTAGCTGCCCATTCTGGATGTTTATTTCGTGGTTTTATTTTTTTTTCTCTATATCCTATACTATTCTGCATATATGCATGTTTCTACTTGTAAAAACGTATGCAATTTAGATTTAAAGGTTTTGTCATTTAAAATTTTTTGTAAGTATTTTTGAAAAGCTACATATTCTCCATCTTTCTAATTCTGGATGGCCATGTTAACTGTTAGTGAAGGAGAATGCTGTAATTGACATTTCCAGAATTCTTTGACTATTTTAAATACTTTTCAGTATTCTTCATGTTTCAGTTAATAGGGAAAATCAGGTGGCCTTGGATCTAGTTGGCTGCATGGGCCTCTGACTTGAGGCTCTGAGGGAGTATGACATGTCAGGGTGTCTGCCCTGTGGCTACCACTAGGAATTCAGCCAGTAGAGCAGAGGCTGGAGCCTGGGCTGTGGGAGGACAGGGAACCACAAATAAGAGCTGGGGCTGGCTTCAGCATCTGCCCAGCAGTAGGCACGATCGAGTGCATCTCGGTCGTGCTGGTAGATCAGTGTGCCCTGGGTTTCCTGTCTTGTGAGTTCTAGATCGGAAGGGGAGCAGAGTGAGGACAAACAGGAGTGCGTTGCACTGCACCGACAGGGCAGGGGGAAGAGCTGTGGCCAGGGGATGAGCCGACCCGTGCTGGCTGCGGGGAGGAGGCTTCCATGCTGCGTGTGGTATTAAGGTACATCACAGCCTAGGGAAGTTTTCTAAAAAGTTTGCCTGCATGCTCGGAATTCTGGTGACCTCCCTCCTCACCCCATACCATCCCGATTTTCTTTCTGAAATTCTTAGACCGTGTAACATTCTTACCAAACAGCCTTCTGTCTCCTCACCACAAAAAGAAAAAGGGTCGGGGGAGCCATCCTGCTCATGCCCTGACATCCCAGCCCGGGCCCTGGCTCTTGCCGTGGCCAGTGCCCATCTCCATCTTTCAGTCAGCGTCTCGCTTGACCTGTGGTGCACGAAGCGCTCTCTGTTCTCACCCTGAACAGCCAGAGCTTCCCCTCCAGCGTTCACGCTGTGCCCAGGGCAGAGCAGATGTGAAAGGCCACCTGGGAAGCTCCCCAGCAGGGTCCTGAGCAACACACAGGTTGTCTGATAAGCGGCTTTGTGTTCGTGGTGGTTTGGTGGCAGAATGATGACCCTCCACTGATGGCCATCCCTAATCCCTGGAACCTGCCAATGTTCCCTAACATGGCAAAGGGAACTTAAGGGTGCTATGAGCCGATTTCAAAACCGAGGTTATCCTGGATCATCAGGTGTGTTCAGTGTTATCACAAGGTTCTTTAAAGGTGAACGAGGAAGGCTGCAGTGATGTGACGGGAAGACTCAACCCACCATTGCTGGCTCTGAAGGTGGAGGAAGGGGGCCATGCTGGGAAAAGCAAGACACCAGTTGTCCCTCTGGAGTCTCGACAGCTTGATTTCAACCCAGTGAGACCTTGTCAGACTTCTGACCTACAGAACCATAGTAATAAATTTGTTATTTTAAGCCATTAAGCTTAGGGTATTTTGTTATAGCAGCGATAGAAAACTAATCCAGGTGGGAACCTTGTAAAAAT