Transcript asmbl_92169

Sequence
Transcript Sequence for observation asmbl_92169 of TGE0004477:
GGGAACTACCGCACCCAGATGTGGGATAAGCACAAGGAGGTCTTCCTGCCCTCGACCCCCGGCCTGGGCATGCACGTGGAGGTGAAGGACCCTGAAGGCAAGGTGGTGCTCTCGCGGCAGTATGGCTCCGAGGGGCGCTTCACCTTTACTTCCCACACCCCTGGCGACCATCAGATCTGCCTGCACTCCAACTCTACCAGGATGGCGCTCTTCGCTGGCGGCAGACTGCGTGTGCACCTGGATATCCAGGTCGGGGAGCATGCCAACAACTACCCAGAGATTGCTGCCAAGGACAAGCTGACAGAGCTGCAGCTGCGGGCCCGCCAGCTGCTCGATCAAGTGGAACAGATCCAGAAGGAGCAGGATTACCAGCGGTACCGAGAAGAGCGCTTTCGTCTGACCAGTGAGAGCACCAACCAGAGGGTCCTGTGGTGGTCCATCGCTCAGACCGTCATTCTCATCCTCACTGGCATCTGGCAGATGCGTCACCTCAAGAGCTTCTTTGAGGCCAAGAAGCTGGTGTAGCGTTCTCTCTGTGTGACCTTTCTCTCTCATCTCAATTATTTGGTACTTTCCCCACCCGATACCTTATCCACTTGAGTTGTGAGGGGAAAAAATGGAGAAAGGATTTAAGCCACATTGGTTTCATGGCAGCAAAGCATCCAGATCGGCCACCCATTAACATTGGATACAGGACATTGGTCCAAGCTTTCACAGGTGTCTTGGGGTTTGCGCACAGTCGGAACTGACCCTGGACTAGGCCTTGCTTCTTGCGCCTCCAGTGAGTCCCCTTCATCCCATCACAAAATGAGCAAAGGAAAAATCCTCCCAACTCCTGTAACTTTCTGTCCTCGTCTGCTCACACAGCGGCGACGGAAATGCCCCACCAAGGAGGCCCCACCTCACTGCTCCCGGTTGGTCCTGGGTTCCCTCAGTGGCTTTCTGAATGTAAATAAGGGCCAGAGGCCTTAGAAGATGGAAGTGTTTTTCTATATATTAGAAGTATTTTTTGATAAATTATATATTTTCCTTCCTAGCTGAAGTGTGACTGCCTGTGTGTGACTAACTGAGCCACAGCGCAGCCACCCCACACTCTGTTTGCCCACAGTTCTGGTGACTTCCGCAGCAGCTCAGGATTTCAGCGGGTCGCACAGCCGACGCCCCAGCTGCTCTCAAGGCCTTAGCAGAGGGCTAAGGAGACCCTCTGGGACACCTGTGCCTCCACCGCACGGGGCCTCAGGGTGATGACAGAGCCGGCACTGGCGGGGCGCTCCTCTCTTCCTCGCCCCTTCACCTGTGGTTAAGCCGTGGTAAATGTTTTCTTCAAGGGAACCAGGGTTGGTTCTTTATACAGATTTTTCCAGTGAAATAAAACTTGTTGCAGTAGCTGTGTTTGAGATGAAAATCTGGGGCCAGAGCGGGGCACAGAGGGGAACGGAGGCTGTTGGCCTGGCTTGCTTCAGCAGCTGACCTGGGGAGGCCACAGCGTGTGTGTTCATGGCGCTCGGGCTTGGCTGAGCAAGTCTCTGGGGATGTGGGTGGACAGGTGCTTGCTCAGCCATTCAGAGGCCAACCAAGTAGACCCCCTCGGCAAGGGGTCATGTGAGGAGGCTGAGTACCCGTGTTTCACTCCCAAAATCAAGTGCAGAGAGATGAGTACACTTCTCTTGACCCTGTTACTGTACGAAACAGTGCTGTTAGCTGCCCATTCTGGATGTTTATTTCGTGGTTTTATTTTTTTTTCTCTATATCCTATACTATTCTGCATATATGCATGTTTCTACTTGTAAAAACGTATGCAATTTAGATTTAAAGGTTTTGTCATTTAAAATTTTTTGTAAGTATTTTTGAAAAGCTACATATTCTCCATCTTTCTAATTCTGGATGGCCATGTTAACTGTTAGTGAAGGAGAATGCTGTAATTGACATTTCCAGAATTCTTTGACTATTTTAAATACTTTTCAGTATTCTTCATGTTTCAGTTAATAGGGAAAATCAGGTGGCCTTGGATCTAGTTGGCTGCATGGGCCTCTGACTTGAGGCTCTGAGGGAGTATGACATGTCAGGGTGTCTGCCCTGTGGCTACCACTAGGAATTCAGCCAGTAGAGCAGAGGCTGGAGCCTGGGCTGTGGGAGGACAGGGAACCACAAATAAGAGCTGGGGCTGGCTTCAGCATCTGCCCAGCAGTAGGCACGATCGAGTGCATCTCGGTCGTGCTGGTAGATCAGTGTGCCCTGGGTTTCCTGTCTTGTGAGTTCTAGATCGGAAGGGGAGCAGAGTGAGGACAAACAGGAGTGCGTTGCACTGCACCGACAGGGCAGGGGGAAGAGCTGTGGCCAGGGGATGAGCCGACCCGTGCTGGCTGCGGGGAGGAGGCTTCCATGCTGCGTGTGGTATTAAGGTACATCACAGCCTAGGGAAGTTTTCTAAAAAGTTTGCCTGCATGCTCGGAATTCTGGTGACCTCCCTCCTCACCCCATACCATCCCGATTTTCTTTCTGAAATTCTTAGACCGTGTAACATTCTTACCAAACAGCCTTCTGTCTCCTCACCACAAAAAGAAAAAGGGTCGGGGGAGCCATCCTGCTCATGCCCTGACATCCCAGCCCGGGCCCTGGCTCTTGCCGTGGCCAGTGCCCATCTCCATCTTTCAGTCAGCGTCTCGCTTGACCTGTGGTGCACGAAGCGCTCTCTGTTCTCACCCTGAACAGCCAGAGCTTCCCCTCCAGCGTTCACGCTGTGCCCAGGGCAGAGCAGATGTGAAAGGCCACCTGGGAAGCTCCCCAGCAGGGTCCTGAGCAACACACAGGTTGTCTGATAAGCGGCTTTGTGTTCGTGGTGGTTTGGTGGCAGAATGATGACCCTCCACTGATGGCCATCCCTAATCCCTGGAACCTGCCAATGTTCCCTAACATGGCAAAGGGAACTTAAGGGTGCTATGAGCCGATTTCAAAACCGAGGTTATCCTGGATCATCAGGTGTGTTCAGTGTTATCACAAGGTTCTTTAAAGGTGAACGAGGAAGGCTGCAGTGATGTGACGGGAAGACTCAACCCACCATTGCTGGCTCTGAAGGTGGAGGAAGGGGGCCATGCTGGGAAAAGCAAGACACCAGTTGTCCCTCTGGAGTCTCGACAGCTTGATTTCAACCCAGTGAGACCTTGTCAGACTTCTGACCTACAGAACCATAGTAATAAATTTGTTATTTTAAGCCATTAAGCTTAGGGTATTTTGTTATAGCAGCGATAGAAAACTAATCCAGGTGGGAACCTTGTAAAAAT