Transcript asmbl_90776

Sequence
Transcript Sequence for observation asmbl_90776 of TGE0004449:
TTTGTGTCTCCGCGCGGCGGCAGGTGAGCGTCCAGCGCGCGGGCTCCCGGGCTTCGCGGCGCACCCCCCGTGTCTTTAGGGCGGGTGGCGGCGGCCGGCCGGGGAGGCGGCCTCGGGCACAGTAATGGCAGCGCTGTGAGCAGGGGAACGCGAGTGACAGCCGCCGCCGCCGCCGCCCACCTTCCTCGCCGGGGCCTCGTCCTTCATTCCTTCGGGCTGCCTCCCCTCCCCTTGTCCCCTGCCCCCTGTCCCGCTTCTGCAGAAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAACTTAAATATTGTAATATGACAGATAACCTTAATAATTGTATCTACATTAAAATGACAAACATGATATTGCTGCTTGTCAAATAAAAAAATAAAGAAGTAGAATGCCTTTTTTATGTGGATGAAGTGTCACACTAAATAATATATATATAAATGTTCATGAGTGATCAGAGCAGCTTTAGTTGCATTTTTATCTGAATGGTTTAATTCACTTGTACTCCTACTTAAATCCTACTGAAAATGTCTAGATTATTGTTCTTGAATACATAAAAATGCATTTAGCATAAAGAATGTTTTCTTTTTAAGGATTAGAACTACATTGGATATGAGCATTTTGAATATTGAGGATTTAATTCCATCAAGACTTTTTGGTGATGTGATATACCACAGAAACAGAGTATAAGGGGAATATGTGGTGACTTTAAATCTGGCATAGAAAGAGCATTTCACTCAAAAGTTATCTTTCTTCTGTTTTCATAATACATTAATTCTAATACAGATTACTGCCCCCAGCTCCGTTGCCTTCCCCTCTACCTTTCTGAGTTGTAGGGGCTCCTGTGATACCTGTCTATCCCTTCTATACCTCTACCTACCTAATACCCTTATACCCCTCTAACATTTTATAAGTCACAGTATTTTTAGCAATGCATAACTTAAAACCTTTTTTTAAAAAATATAGTATTTTACTTGAGGTGCCATTTATATAGAGATATGAAATTTCATTATTTTGTTTATTAAATATGTCAACAGCAGTATTAGAATACTCTGGTCTGTTATCATATTTTTTATCTATTTACCCTACCTTCCCCACCACCATAATACATACACACAATTTTTTTTAAGCTGGAATCTTTTAAAGTATATTCTACATAAATCATTTCACTTAAAATACTTTGGTTTATGTCTAACAGTTAAGGCCTTTTCAAAAAAAGTAAAAAACAACATTACACCTTACAAATAAACCGTAATTAATATCATCTAATATGTAGTCTATATTCAAATTTCTCCTATTATTATAAAAATGGCTTTTACAGTTGGTTTCTTCAGTTGCACCTTTCCTAACTCGTCTCTTAAGTGTTTAAAATACCTGAGCTTATAATGACTCATTTTACCTTTCTAGAGAGGAAATAATGGCAAACCATATAATGTACATTTCACTGTCAAAAAACAAATCTTTGTTTTGATAACTTGTTGATAAAGTTTTCCAAATTGATTCCTTTTTTCTTAAATATCTATAAATGTTAAATCAAGTCTTATCCCGGTATCTAATTGTCAAGAAAATATATTGAAAAATGGACAATACCTGTGCTGAGGTCTACAGACGTGACTGTCAGGTTTTCATCACATCATTTTCCCATTTTATCTGAAAGGAAATATATTAAAGATATGCTTGTGCATGAAAAGAGGACAGATGCATTTAACCAAGTCACCATCCCAAAAGGGAACAGTGTTTAGAATGAACTTTAGGCCATCATTCTCAAGTTGCATCAGGTAGTTGAAATCATTACTACAGGAGACCTGAGCACACAGCTCAGAGTAGGTCGTACAACACCTAGTACTTGTGGGCAGAATGAGTCAGAGCTTCAAATGGAAAGAAGAGGAAGGAAAGGAGAGGGTTCTTTGTGCTTTATCTCAGAAAACCAAAAATAATGTGAGCAGAACTTTCAGAGGTTTTAAAAAATGTATTAATACTGAAGGAGTTAACATGTCTGAGCCTGTGATACAATTTACAGCCAGATAGCATGCAGCTCTGGTCAATACTCCATCCTTTCTCTTTGAAACCAGTTATTTTAATTGCTACCATAGGTACAGACTTATTCTAGAGTTTAATCCGATATTTTATGACAGTTTACTTTAATGTAAACAAAAGAATAGATACTCTGAGGTTTGTGTTTTACTTTATGTATAACTTAGTATACCTATAGGATTTTGTAACCTGTATATCCTCTAGTTCTATAAAATTTCTGTTAATTTTTTGAACCTTTATTGAGCACAGACTGACAGGTGCTTCCACATATGTTGTTTTGTTTGATCAGATAATCTTGTTAACTAGGCAATGTTCCTCTCTTTCATAGATGAGGAAACTAGATGAGAGGAGTTTTTCAGGAATCATTGCCAGAAACTGCAGAACTTGAATTTAATCCTAGTCAAAGCTGTGGACCAAATAAATGCAGTCTTTCTATATATAGTATAACCTGTAAGACATAGAAATAACTTCATTTTATATGTTAAGAATAGTTTTTCCTGACTTTTCAGGGGGAAAAAATGTGTTCTTATTAAATAATTTGTGATAATAAACTTCATATTTTTGTTTTCTTAAAATACTTAAGATGTAAATATACATGGTTAAATGACATGACTCACAGCTGATTCATGGCAAAG