Transcript asmbl_90775

Sequence
Transcript Sequence for observation asmbl_90775 of TGE0004449:
GGCCTTTCGCAATTGCACTAAAGCGGGCTCTCTGCGCTTGCCGTAACATGGACTCTACCACTGCGCTCCGAGGGGGGACTTTGAGGTAGCGGAAGAGGGAGGGTGTGTGTTGGGAAAAGTCGGGCGCTCGGGAAGACGGTTGTTTCACGGATCCGGTAACCAGCCTGTCCTTTTTCCCCTCCCCACTCCCCTTTTCCCCTGTCCCGACCCGGCTTCTTTGTGTCTCCGCGCGGCGGCAGATTTCAACACTAAACTTGCACAATGTCTTTGAAACCAAGAGTAGTAGATTTTGATGAAACATGGAACAAACTTTTAACGACAATCAAAGCTGTTGTCATGTTGGAATACGTCGAAAGAGCAACATGGAACGATCGCTTCTCAGATATCTATGCTTTATGTGTGGCCTATCCTGAACCCCTTGGAGAAAGACTTTATACAGAAACTAAAATTTTTTTGGAAAATCACGTACGGCATTTGCACAAGAGAGTTCTGGAATCCGAAGAGCAAGTACTTGTTATGTATCATAGGTATTGGGAGGAATATAGCAAGGGTGCAGACTATATGGACTGCTTGTATAGGTATCTCAACACCCAATTTATTAAAAAGAATAAATTGACAGAAGCTGACCTTCAGTATGGCTATGGTGGTGTAGATATGAATGAACCACTTATGGAAATAGGAGAGCTAGCATTGGATATGTGGAGGAAATTGATGGTTGAACCACTTCAGACCATCCTTATCCGAATGCTGCTCCGAGAAATCAAAAATGATCGTGGTGGAGAAGACCCAAACCAGAAAGTAATCCACGGGGTTATTAACTCCTTTGTTCATGTTGAACAGTATAAGAAAAAATTCCCCTTAAAGTTTTATCAGGAAATCTTTGAGTCTCCCTTTCTGACTGAAACAGGAGAGTATTACAAACAAGAAGCTTCAAATTTATTACAAGAATCAAACTGCTCACAGTATATGGAAAAGGTTCTAGGTAGATTAAAAGATGAAGAAATTCGATGTCGAAAATACTTGCATCCAAGTTCATATACTAAAGTGATTCATGAGTGTCAGCAACGAATGGTAGCAGACCACTTACAGTTCTTACATGCAGAATGTCATAATATCATTCGACAAGAGAAAAAAAATGACATGGCAAATATGTATGTCTTACTCCGTGCTGTGTCCACTGGTTTACCTCATATGATTCAGGAGCTGCAAAACCATATCCATGATGAGGGCCTTAGAGCAACCAGTAATCTTACTCAGGAAAATATGCCAACACTATTTGTGGAGTCAGTTTTGGAAGTACATGGTAAATTTGTTCAACTTATCAACACTGTTTTGAATGGTGATCAGCACTTTATGAGTGCATTGGATAAGGCCCTCACATCAGTTGTAAATTACAGAGAACCCAAGTCTGTTTGCAAAGCTCCTGAATTGCTTGCTAAGTACTGTGACAACTTACTAAAGAAATCAGCGAAGGGGATGACTGAGAATGAAGTGGAAGACAAACTCACCAGCTTCATTACTGTTTTCAAATACATTGATGATAAGGATGTTTTTCAAAAGTTCTACGCAAGAATGCTGGCAAAACGTTTAATTCACGGGTTATCTATGTCTATGGATTCTGAAGAAGCCATGATCAATAAATTAAAGCAAGCCTGTGGTTATGAGTTTACCAGCAAGCTACATCGGATGTATACAGATATGAGTGTCAGTGCTGACCTTAACAATAAGTTCAACAATTTTATCAAAAATCAAGACACTGTTATAGATTTGGGGATTAGTTTTCAAATATATGTTCTACAGGCTGGCGCATGGCCTCTTACTCAGGCTCCTTCATCTACATTTGCAATTCCCCAGGAATTGGAAAAAAGTGTACAGATGTTTGAATTATTTTACAGCCAGCATTTCAGTGGAAGGAAACTTACGTGGTTACATTATCTCTGTACAGGTGAAGTTAAAATGAACTATTTGGGCAAACCATATGTAGCCATGGTTACAACATACCAAATGGCAGTTCTTCTAGCCTTTAACAACAGTGAAACTGTCAGCTATAAAGAGCTTCAAGACAGCACTCAGATGAATGAAAAGGAACTGACAAAAACAATCAAATCATTACTTGATGTGAAAATGATTAACCATGATTCAGAAAAGGAAGATATCGATGCAGAATCTTCATTTTCATTAAATATGAACTTCAGCAGTAAAAGAACAAAATTTAAAATTACTACATCGATGCAGAAAGACACACCACAGGAAATGGAACAGACTAGAAGTGCTGTAGATGAGGACCGGAAAATGTATCTCCAAGCTGCTATAGTTCGTATCATGAAAGCACGAAAAGTACTTCGGCATAATGCTCTTATTCAAGAGGTGATTAGCCAGTCAAGAGCTAGGTTTAATCCTAGTATCAGCATGATTAAGAAGTGTATTGAAGTGCTGATAGACAAACAGTACATTGAACGCAGCCAAGCATCAGCAGATGAATACAGTTACGTAGCGTGATGTCGCTCTCCTCCTGTGTGATGTGAGAAGATCATTGCCATCACCATTTGGCGTGTTCCTGTGGGAAAAAGCAGGCCTGTGCCTCCATAATTTGGTCATTTGGCAGCCCCTGTTTTTCTGCTGTTTACAACATCACCAGTGCCACGTCATGAGCGTCAGAGAAAATGCCTAGAGATATTTCAAGCTCATGTCATTATGACATTTCTTAAAACTTTATTAAAAGAATGAGTGAAGTATTGCTGACATGTGGAAATTTGGTTGGGTACCATGCTTTTTCTCCCCTTCACGTTTGCAGTTGATGTGTTTTTTTTTTAATGTATCTTAAAGGACATAAAATAAAAACTTAAATATTGTAATATGACAGATAACCTTAATAATTGTATCTACATTAAAATGACAAACATGATATTGCTGCTTGTCAAATAAAAAAATAAAGAAGTAGAATGCCTTTTTTATGTGGATGAAGTGTCACACTAAATAATATATATATAAATGTTCATGAGTGATCAGAGCAGCTTTAGTTGCATTTTTATCTGAATGGTTTAATTCACTTGTACTCCTACTTAAATCCTACTGAAAATGTCTAGATTATTGTTCTTGAATACATAAAAATGCATTTAGCATAAAGAATGTTTTCTTTTTAAGGATTAGAACTACATTGGATATGAGCATTTTGAATATTGAGGATTTAATTCCATCAAGACTTTTTGGTGATGTGATATACCACAGAAACAGAGTATAAGGGGAATATGTGGTGACTTTAAATCTGGCATAGAAAGAGCATTTCACTCAAAAGTTATCTTTCTTCTGTTTTCATAATACATTAATTCTAATACAGATTACTGCCCCCAGCTCCGTTGCCTTCCCCTCTACCTTTCTGAGTTGTAGGGGCTCCTGTGATACCTGTCTATCCCTTCTATACCTCTACCTACCTAATACCCTTATACCCCTCTAACATTTTATAAGTCACAGTATTTTTAGCAATGCATAACTTAAAACCTTTTTTTAAAAAATATAGTATTTTACTTGAGGTGCCATTTATATAGAGATATGAAATTTCATTATTTTGTTTATTAAATATGTCAACAGCAGTATTAGAATACTCTGGTCTGTTATCATATTTTTTATCTATTTACCCTACCTTCCCCACCACCATAATACATACACACAATTTTTTTTAAGCTGGAATCTTTTAAAGTATATTCTACATAAATCATTTCACTTAAAATACTTTGGTTTATGTCTAACAGTTAAGGCCTTTTCAAAAAAAGTAAAAAACAACATTACACCTTACAAATAAACCGTAATTAATATCATCTAATATGTAGTCTATATTCAAATTTCTCCTATTATTATAAAAATGGCTTTTACAGTTGGTTTCTTCAGTTGCACCTTTCCTAACTCGTCTCTTAAGTGTTTAAAATACCTGAGCTTATAATGACTCATTTTACCTTTCTAGAGAGGAAATAATGGCAAACCATATAATGTACATTTCACTGTCAAAAAACAAATCTTTGTTTTGATAACTTGTTGATAAAGTTTTCCAAATTGATTCCTTTTTTCTTAAATATCTATAAATGTTAAATCAAGTCTTATCCCGGTATCTAATTGTCAAGAAAATATATTGAAAAATGGACAATACCTGTGCTGAGGTCTACAGACGTGACTGTCAGGTTTTCATCACATCATTTTCCCATTTTATCTGAAAGGAAATATATTAAAGATATGCTTGTGCATGAAAAGAGGACAGATGCATTTAACCAAGTCACCATCCCAAAAGGGAACAGTGTTTAGAATGAACTTTAGGCCATCATTCTCAAGTTGCATCAGGTAGTTGAAATCATTACTACAGGAGACCTGAGCACACAGCTCAGAGTAGGTCGTACAACACCTAGTACTTGTGGGCAGAATGAGTCAGAGCTTCAAATGGAAAGAAGAGGAAGGAAAGGAGAGGGTTCTTTGTGCTTTATCTCAGAAAACCAAAAATAATGTGAGCAGAACTTTCAGAGGTTTTAAAAAATGTATTAATACTGAAGGAGTTAACATGTCTGAGCCTGTGATACAATTTACAGCCAGATAGCATGCAGCTCTGGTCAATACTCCATCCTTTCTCTTTGAAACCAGTTATTTTAATTGCTACCATAGGTACAGACTTATTCTAGAGTTTAATCCGATATTTTATGACAGTTTACTTTAATGTAAACAAAAGAATAGATACTCTGAGGTTTGTGTTTTACTTTATGTATAACTTAGTATACCTATAGGATTTTGTAACCTGTATATCCTCTAGTTCTATAAAATTTCTGTTAATTTTTTGAACCTTTATTGAGCACAGACTGACAGGTGCTTCCACATATGTTGTTTTGTTTGATCAGATAATCTTGTTAACTAGGCAATGTTCCTCTCTTTCATAGATGAGGAAACTAGATGAGAGGAGTTTTTCAGGAATCATTGCCAGAAACTGCAGAACTTGAATTTAATCCTAGTCAAAGCTGTGGACCAAATAAATGCAGTCTTTCTATATATAGTATAACCTGTAAGACATAGAAATAACTTCATTTTATATGTTAAGAATAGTTTTTCCTGACTTTTCAGGGGGAAAAAATGTGTTCTTATTAAATAATTTGTGATAATAAACTTCATATTTTTGTTTTCTTAAAATACTTAAGATGTAAATATACATGGTTAAATGACATGACTCACAGCTGATTCATGGCAAAG