Transcript asmbl_90549

Sequence
Transcript Sequence for observation asmbl_90549 of TGE0074156:
GAGGCGGAGTTAGGGAAGAGCCGCCCCAGCGGGCGTGTGGCAGCGGGTTTCGCATGGTCCAATGAGGGCGGGCGGCGTGGCCCGGCCTGGTGGCGACGGTGATGCGCATGCGCAGAGGCGGCAGCACGCTGGGGTTGACTCCGGGGGCGCGGCGAGGAGAGACATGAGGCTGAACTGGGTCCTGACAATACTGTCCATCTGCCTGAGCGCCCTGGCCACGGCCGCAGGGGCCGAGGGCAAACGGAAGCTGCAGATCGGGGTCAAGAAGCGGGTAGACCACTGTCCCATCAAATCGCGCAAGGGGGACGTCCTGCACATGCACTACACGGGGAAGCTGGAAGATGGGACAGAATTTGACAGCAGCCTGCCCCAGAACCAGCCCTTTGTCTTCTCCCTGGGCACGGGCCAGGTCATCAAGGGTTGGGACCAGGGGCTGCTGGGGATGTGTGAAGGGGAAAAGCGGAAGCTGGTGATTCCATCAGAGTTGGGATATGGAGAGCGGGGAGCCCCGCCAAAGATTCCAGGTGGTGCAACCCTGGTGTTCGAGGTGGAACTGCTCAAAATCGAGCGACGTTCAGAACTGTAGCAAAGCTGGGGAGGGGCAGCGGAGAGGCCATCAGGGACCAGACTGTTTAAAAGAAAAACAAAAACAAA