Transcript asmbl_90526

Sequence
Transcript Sequence for observation asmbl_90526 of TGE0004412:
TGAGGGTCCGGCCAATAAACTGTGCTGTCGGTGGGCATGATAGCCAATAGGAGCAGGGAGAGGGGTCCCGGGACTGAAAACGGCTGCCGGAGGGGGCTACGGGGATCATGGGCCTTTTGACCATCCTGAAGAAGATGAAGCAGAAAGAGCGGGAGCTGCGACTGCTCATGCTTGGCCTGGACAATGCTGGCAAAACAACCATCCTCAAGAAGTTCAATGGAGAGGACATCGACACCATCTCTCCAACGCTGGGCTTCAACATCAAGACCCTGGAGCACCGGGGATTCAAGCTGAACATATGGGATGTGGGCGGCCAGAAGTCCCTGCGCTCCTACTGGCGAAACTACTTTGAGAGCACGGATGGCCTCATCTGGGTGGTGGACAGCGCTGACCGCCAGCGCATGCAGGATTGCCAGCGCGAGCTCCAGAGCCTGTTGGTGGAGGAGCGCCTGGCCGGAGCCACCCTCCTCGTCTTTGCCAACAAGCAGGACCTTCCCGGAGCACTGTCCTCTAATGCCATCCGTGAGGCCCTGGAGCTGGACTCCATCCACAGCCACCACTGGTGCATCCAGGGCTGCAGCGCCGTCACTGGGGAGAACCTGCTGCCCGGCATTGACTGGCTCCTGGATGACATTTCCAGCCGCATCTTCACGGCCGACTGAGCCGCTCCAGACGCCCCGACATCACAGTCTGGGTCGTCCCTTCTACCCCCTGGCCCTCACCAAGCACCATCCGTGGGAGGATGGGAATCAGCCAGCCCAACTAACACTCCCCAACCCCTCCGTAACCTGCTGCCGCCGCCCGCTGCTGCTCCGTGGCCAGCCAGCTCCCATGACAGGAGGGCTGCCCTCCTGGCTGTCACCCTGGCTCCTGACCTGGCCCTGCAGCTGCCATACCAAGAGGTGAGGGTTGGGGCTGGGCGGGGGCTGTCTCTGCTGCTATGGAGGCTGTGGGCCTCGTCCTTTGCTCAGCTGTAAGAATAAACAGTTCCTTGCCCCTA