Transcript asmbl_90125

Sequence
Transcript Sequence for observation asmbl_90125 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGGTGAGCTGGTCACTACACTCCGCGCCCCCTCCGCCCAAAATAGGCCCTTGACGTGAGGGGACAGAGCTCGCTCTGACACAGGACCACGTATGTGTGAGCTAAGCAGTCGGCTCTAGGCACAGCGGCCTGGCGGACACCTGCCCAGATGCACAGTGGGGGCCATGGGAGGTGCCCAGACGAAGGCCTTGCCACAGCACGGGTACCCCGAACATTACGCAGCTCACACACGGGGTCCCCACCACCAAGCACCAGGCAGGCAGGCAGTCTGGAAAGTTCCGTGGCCAGTCAGGGAGCAGCCCAGCTCCAAATGCTTCTCTCTGGGTGCTGTAGCCCGTCACCCTAGAGCTGGCCCCCTGGGCACAGGCGGCTGTGACAGTGCCAGCCCAGGCCTCATGCCGTTTTGCCCTCCCGCTGCCCCTCGTCTGGGCACAGAGGCCAGCAAGGCCTGTCTCCCTCCAGTCTGGCCCATGTCCACCCTCTCTTCTTTCTTCTCTGCGGTGTGAAATCCCAGGTCAGGGCTCAGGCAGAGGAGTCTCGGTTCACCCGCATGGTGGTGGGGTGGCAGGCAGTGGCCGGAAGCCCCCACTTTCAGCTTGGGAAGCATCCTCCTGCTTCGTCTCATTCCTTTCAGTGCTCAGTGACTGAAACCTCCACCCTGGAGCCGAGGAGAAGCCCACAGTCGTGCAGGGGCCGGAGGGGGCTGGGGCCAAAGGCAGAGTGCCCCCCCACCATGTGGCACCTGCTAGCCCATCCCTCCCATGTGCACACTCCTCATCCAGCACATTTGTTCAGGTGTCTTTCTGGCCTCATGGTGGCTGAACTGCTCAGAGCAGCCCCCTCATAGGTTGGCAGCTGCAATCTCAGCCTGGTCAGGGGAGTGACAGGTGATTCTGGGGTCCCTCTCCCCCAGGCTGCAGTCTTTGGTGATTCTGTCAGGAGCGGGGCTGGTGGGGAGGGGCGAGGTCAGAGGGCATGATCTGGGTGTGGGTCTGCATATCCTTCCTTCACACCCCCTCGCAGCTGCCCTGTCTGTCAGGGCGAGTGCTGCCTTTCACGGGAGCTCCTTGTCCCTTCTGTCCTCAGAAGCCTTTGAGCCAGGCCATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGGTGAGGCAGAATTGCATGGGGGGGGCGGTGGTCCCAGGACCTGAAAATGAACTGCGCAACTAATAAAAGTCCAGTGCAGAAAACACAGCTGAAGCCAGAGGGCCACATGTCCCTCAGGTCAGACAGCCAGCTCATTTGCTGCTCAGTGTCCCCTTTCCATTCCGTTTCTGTGGGTGAACCCACAAGAGTTTGAATAAAGACAGACCCGTGTGCTGAGTGTGTGTCCTAACGTTTGCTCCGGCCGAGCATCGCCGAGCCTGTCCGTGTTCCAGCAGGAGGGAGTGCGGGTTACTCTCTGCGAAGAACATCATTGCGTGTTCTCCGCGCGTGTGGGGAAGTCCCCCAAAGTGGCATCTGTGAAAGAAAAACGTGTCAGAAAGCGCGGTATTCGTGGACCGCGGTCATCCAGAGGCCTCCCCAGCTCGCATGCTGCGGCCGCAAGGCAGCCCCTTCCCGCGGTCCTCGCAGACCCGCCGGCGGAGACGCGTCTGATTCCCGCGTCCGGTCCTCTGATTTCTTGCAAAGCTGAGGGGCCATTTCTGGGGCGTGGGGCAGCTTTGTATTCGTTCTTTTTGCATCCTTTATTTTTGTGGTGGGGCATTTTTTATTAGAGCATTTTCTATTCTTAATTCGTGGGCGTTCTTTATATCTTCCGGGTACGTGACGGATGGAAATCCGCTGCTACTTGTGTCCTAAGTCCTTTTTTTCCTGGTTTGCTTTTTCCGTTTCCCGATTGGAAGTTTTGTGTTCTCACCTGTGAGCATTTCCTTCCATAACCTCCGCTGTTGCTGACGTAGTTGGAAAAGGCCCCCACCCCTGAGTTGACATGAACGGGCACCCATGTTTTCAGTCTGCTGAGGGAGGGGAGAGCCAGCTGTGAGAGAAGCCAGGGGCCACCTGTGCTGGCAGCTGGACTCCGGCCAGCAGGGCGGTCCAGGGCTGGGCTCCATCCTGGGGCCAGTGCCCAGCCCAGTGCTACGAGAACCCAGGCTCTATTATGACAGGTTCCCCAGTCAGCAGAGGGGTTGGCCCACGCTGCTGCTGGTCTCCATGTGCCCTGCTCTCCCGGCAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC