Transcript asmbl_90123

Sequence
Transcript Sequence for observation asmbl_90123 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC