Transcript asmbl_90122

Sequence
Transcript Sequence for observation asmbl_90122 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTGAGCCCCGCGGCGGCCGGCCGGGGAGGTGTCCGCGCCCCGCGTTCCGGACTCCTGCTCCTCCTCTGCACATGGCCTCAGTTCCCCTCCGCGAAGTGGGCGCGGGCGGCGCGAGGGAGAGCGGTGTGAGCGGGCGTGGACCAGAGGGGCGTGTGCGCCAGAGCGTGTGGGTGCCGGTGGGAGGCCCAGAGAGTGAGACCTTGGACGAGCGTGAGGGACCACGAACCTGAGTGGGGACAGCACACGACAGGTGGTAGGGCCCAGAGAGCGGTGGCCAACCTGTCCCAGGGGCCGAGAGGCCAGGCCGGAGTGCGGGGCAAGTGACCCCATGCTTGTTGGGGTGCACTGGGCTGGACCCCACCTCGCTCAGCCCCCAGGCTTGAAAGCGTAGATTTTCCACACAGAACAGTGATTCAACCGCTCCTCGCTTCCCAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGGTGAGCTGGTCACTACACTCCGCGCCCCCTCCGCCCAAAATAGGCCCTTGACGTGAGGGGACAGAGCTCGCTCTGACACAGGACCACGTATGTGTGAGCTAAGCAGTCGGCTCTAGGCACAGCGGCCTGGCGGACACCTGCCCAGATGCACAGTGGGGGCCATGGGAGGTGCCCAGACGAAGGCCTTGCCACAGCACGGGTACCCCGAACATTACGCAGCTCACACACGGGGTCCCCACCACCAAGCACCAGGCAGGCAGGCAGTCTGGAAAGTTCCGTGGCCAGTCAGGGAGCAGCCCAGCTCCAAATGCTTCTCTCTGGGTGCTGTAGCCCGTCACCCTAGAGCTGGCCCCCTGGGCACAGGCGGCTGTGACAGTGCCAGCCCAGGCCTCATGCCGTTTTGCCCTCCCGCTGCCCCTCGTCTGGGCACAGAGGCCAGCAAGGCCTGTCTCCCTCCAGTCTGGCCCATGTCCACCCTCTCTTCTTTCTTCTCTGCGGTGTGAAATCCCAGGTCAGGGCTCAGGCAGAGGAGTCTCGGTTCACCCGCATGGTGGTGGGGTGGCAGGCAGTGGCCGGAAGCCCCCACTTTCAGCTTGGGAAGCATCCTCCTGCTTCGTCTCATTCCTTTCAGTGCTCAGTGACTGAAACCTCCACCCTGGAGCCGAGGAGAAGCCCACAGTCGTGCAGGGGCCGGAGGGGGCTGGGGCCAAAGGCAGAGTGCCCCCCCACCATGTGGCACCTGCTAGCCCATCCCTCCCATGTGCACACTCCTCATCCAGCACATTTGTTCAGGTGTCTTTCTGGCCTCATGGTGGCTGAACTGCTCAGAGCAGCCCCCTCATAGGTTGGCAGCTGCAATCTCAGCCTGGTCAGGGGAGTGACAGGCTGCAGTCTTTGGTGATTCTGTCAGGAGCGGGGCTGGTGGGGAGGGGCGAGGTCAGAGGGCATGATCTGGGTGTGGGTCTGCATATCCTTCCTTCACACCCCCTCGCAGCTGCCCTGTCTGTCAGGGCGAGTGCTGCCTTTCACGGGAGCTCCTTGTCCCTTCTGTCCTCAGAAGCCTTTGAGCCAGGCCATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGGTGAGGCAGAATTGCATGGGGGGGGCGGTGGTCCCAGGACCTGAAAATGAACTGCGCAACTAATAAAAGTCCAGTGCAGAAAACACAGCTGAAGCCAGAGGGCCACATGTCCCTCAGGTCAGACAGCCAGCTCATTTGCTGCTCAGTGTCCCCTTTCCATTCCGTTTCTGTGGGTGAACCCACAAGAGTTTGAATAAAGACAGACCCGTGTGCTGAGTGTGTGTCCTAACGTTTGCTCCGGCCGAGCATCGCCGAGCCTGTCCGTGTTCCAGCAGGAGGGAGTGCGGGTTACTCTCTGCGAAGAACATCATTGCGTGTTCTCCGCGCGTGTGGGGAAGTCCCCCAAAGTGGCATCTGTGAAAGAAAAACGTGTCAGAAAGCGCGGTATTCGTGGACCGCGGTCATCCAGAGGCCTCCCCAGCTCGCATGCTGCGGCCGCAAGGCAGCCCCTTCCCGCGGTCCTCGCAGACCCGCCGGCGGAGACGCGTCTGATTCCCGCGTCCGGTCCTCTGATTTCTTGCAAAGCTGAGGGGCCATTTCTGGGGCGTGGGGCAGCTTTGTATTCGTTCTTTTTGCATCCTTTATTTTTGTGGTGGGGCATTTTTTATTAGAGCATTTTCTATTCTTAATTCGTGGGCGTTCTTTATATCTTCCGGGTACGTGACGGATGGAAATCCGCTGCTACTTGTGTCCTAAGTCCTTTTTTTCCTGGTTTGCTTTTTCCGTTTCCCGATTGGAAGTTTTGTGTTCTCACCTGTGAGCATTTCCTTCCATAACCTCCGCTGTTGCTGACGTAGTTGGAAAAGGCCCCCACCCCTGAGTTGACATGAACGGGCACCCATGTTTTCAGTCTGCTGAGGGAGGGGAGAGCCAGCTGTGAGAGAAGCCAGGGGCCACCTGTGCTGGCAGCTGGACTCCGGCCAGCAGGGCGGTCCAGGGCTGGGCTCCATCCTGGGGCCAGTGCCCAGCCCAGTGCTACGAGAACCCAGGCTCTATTATGACAGGTTCCCCAGTCAGCAGAGGGGTTGGCCCACGCTGCTGCTGGTCTCCATGTGCCCTGCTCTCCCGGCAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC