Transcript asmbl_90121

Sequence
Transcript Sequence for observation asmbl_90121 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTGAGCCCCGCGGCGGCCGGCCGGGGAGGTGTCCGCGCCCCGCGTTCCGGACTCCTGCTCCTCCTCTGCACATGGCCTCAGTTCCCCTCCGCGAAGTGGGCGCGGGCGGCGCGAGGGAGAGCGGTGTGAGCGGGCGTGGACCAGAGGGGCGTGTGCGCCAGAGCGTGTGGGTGCCGGTGGGAGGCCCAGAGAGTGAGACCTTGGACGAGCGTGAGGGACCACGAACCTGAGTGGGGACAGCACACGACAGGTGGTAGGGCCCAGAGAGCGGTGGCCAACCTGTCCCAGGGGCCGAGAGGCCAGGCCGGAGTGCGGGGCAAGTGACCCCATGCTTGTTGGGGTGCACTGGGCTGGACCCCACCTCGCTCAGCCCCCAGGCTTGAAAGCGTAGATTTTCCACACAGAACAGTGATTCAACCGCTCCTCGCTTCCCAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGGTGAGCTGGTCACTACACTCCGCGCCCCCTCCGCCCAAAATAGGCCCTTGACGTGAGGGGACAGAGCTCGCTCTGACACAGGACCACGTATGTGTGAGCTAAGCAGTCGGCTCTAGGCACAGCGGCCTGGCGGACACCTGCCCAGATGCACAGTGGGGGCCATGGGAGGTGCCCAGACGAAGGCCTTGCCACAGCACGGGTACCCCGAACATTACGCAGCTCACACACGGGGTCCCCACCACCAAGCACCAGGCAGGCAGGCAGTCTGGAAAGTTCCGTGGCCAGTCAGGGAGCAGCCCAGCTCCAAATGCTTCTCTCTGGGTGCTGTAGCCCGTCACCCTAGAGCTGGCCCCCTGGGCACAGGCGGCTGTGACAGTGCCAGCCCAGGCCTCATGCCGTTTTGCCCTCCCGCTGCCCCTCGTCTGGGCACAGAGGCCAGCAAGGCCTGTCTCCCTCCAGTCTGGCCCATGTCCACCCTCTCTTCTTTCTTCTCTGCGGTGTGAAATCCCAGGTCAGGGCTCAGGCAGAGGAGTCTCGGTTCACCCGCATGGTGGTGGGGTGGCAGGCAGTGGCCGGAAGCCCCCACTTTCAGCTTGGGAAGCATCCTCCTGCTTCGTCTCATTCCTTTCAGTGCTCAGTGACTGAAACCTCCACCCTGGAGCCGAGGAGAAGCCCACAGTCGTGCAGGGGCCGGAGGGGGCTGGGGCCAAAGGCAGAGTGCCCCCCCACCATGTGGCACCTGCTAGCCCATCCCTCCCATGTGCACACTCCTCATCCAGCACATTTGTTCAGGTGTCTTTCTGGCCTCATGGTGGCTGAACTGCTCAGAGCAGCCCCCTCATAGGTTGGCAGCTGCAATCTCAGCCTGGTCAGGGGAGTGACAGGCTGCAGTCTTTGGTGATTCTGTCAGGAGCGGGGCTGGTGGGGAGGGGCGAGGTCAGAGGGCATGATCTGGGTGTGGGTCTGCATATCCTTCCTTCACACCCCCTCGCAGCTGCCCTGTCTGTCAGGGCGAGTGCTGCCTTTCACGGGAGCTCCTTGTCCCTTCTGTCCTCAGAAGCCTTTGAGCCAGGCCATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC