Transcript asmbl_90120

Sequence
Transcript Sequence for observation asmbl_90120 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGGTGAGCTGGTCACTACACTCCGCGCCCCCTCCGCCCAAAATAGGCCCTTGACGTGAGGGGACAGAGCTCGCTCTGACACAGGACCACGTATGTGTGAGCTAAGCAGTCGGCTCTAGGCACAGCGGCCTGGCGGACACCTGCCCAGATGCACAGTGGGGGCCATGGGAGGTGCCCAGACGAAGGCCTTGCCACAGCACGGGTACCCCGAACATTACGCAGCTCACACACGGGGTCCCCACCACCAAGCACCAGGCAGGCAGGCAGTCTGGAAAGTTCCGTGGCCAGTCAGGGAGCAGCCCAGCTCCAAATGCTTCTCTCTGGGTGCTGTAGCCCGTCACCCTAGAGCTGGCCCCCTGGGCACAGGCGGCTGTGACAGTGCCAGCCCAGGCCTCATGCCGTTTTGCCCTCCCGCTGCCCCTCGTCTGGGCACAGAGGCCAGCAAGGCCTGTCTCCCTCCAGTCTGGCCCATGTCCACCCTCTCTTCTTTCTTCTCTGCGGTGTGAAATCCCAGGTCAGGGCTCAGGCAGAGGAGTCTCGGTTCACCCGCATGGTGGTGGGGTGGCAGGCAGTGGCCGGAAGCCCCCACTTTCAGCTTGGGAAGCATCCTCCTGCTTCGTCTCATTCCTTTCAGTGCTCAGTGACTGAAACCTCCACCCTGGAGCCGAGGAGAAGCCCACAGTCGTGCAGGGGCCGGAGGGGGCTGGGGCCAAAGGCAGAGTGCCCCCCCACCATGTGGCACCTGCTAGCCCATCCCTCCCATGTGCACACTCCTCATCCAGCACATTTGTTCAGGTGTCTTTCTGGCCTCATGGTGGCTGAACTGCTCAGAGCAGCCCCCTCATAGGTTGGCAGCTGCAATCTCAGCCTGGTCAGGGGAGTGACAGGCTGCAGTCTTTGGTGATTCTGTCAGGAGCGGGGCTGGTGGGGAGGGGCGAGGTCAGAGGGCATGATCTGGGTGTGGGTCTGCATATCCTTCCTTCACACCCCCTCGCAGCTGCCCTGTCTGTCAGGGCGAGTGCTGCCTTTCACGGGAGCTCCTTGTCCCTTCTGTCCTCAGAAGCCTTTGAGCCAGGCCATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGGTGAGGCAGAATTGCATGGGGGGGGCGGTGGTCCCAGGACCTGAAAATGAACTGCGCAACTAATAAAAGTCCAGTGCAGAAAACACAGCTGAAGCCAGAGGGCCACATGTCCCTCAGGTCAGACAGCCAGCTCATTTGCTGCTCAGTGTCCCCTTTCCATTCCGTTTCTGTGGGTGAACCCACAAGAGTTTGAATAAAGACAGACCCGTGTGCTGAGTGTGTGTCCTAACGTTTGCTCCGGCCGAGCATCGCCGAGCCTGTCCGTGTTCCAGCAGGAGGGAGTGCGGGTTACTCTCTGCGAAGAACATCATTGCGTGTTCTCCGCGCGTGTGGGGAAGTCCCCCAAAGTGGCATCTGTGAAAGAAAAACGTGTCAGAAAGCGCGGTATTCGTGGACCGCGGTCATCCAGAGGCCTCCCCAGCTCGCATGCTGCGGCCGCAAGGCAGCCCCTTCCCGCGGTCCTCGCAGACCCGCCGGCGGAGACGCGTCTGATTCCCGCGTCCGGTCCTCTGATTTCTTGCAAAGCTGAGGGGCCATTTCTGGGGCGTGGGGCAGCTTTGTATTCGTTCTTTTTGCATCCTTTATTTTTGTGGTGGGGCATTTTTTATTAGAGCATTTTCTATTCTTAATTCGTGGGCGTTCTTTATATCTTCCGGGTACGTGACGGATGGAAATCCGCTGCTACTTGTGTCCTAAGTCCTTTTTTTCCTGGTTTGCTTTTTCCGTTTCCCGATTGGAAGTTTTGTGTTCTCACCTGTGAGCATTTCCTTCCATAACCTCCGCTGTTGCTGACGTAGTTGGAAAAGGCCCCCACCCCTGAGTTGACATGAACGGGCACCCATGTTTTCAGTCTGCTGAGGGAGGGGAGAGCCAGCTGTGAGAGAAGCCAGGGGCCACCTGTGCTGGCAGCTGGACTCCGGCCAGCAGGGCGGTCCAGGGCTGGGCTCCATCCTGGGGCCAGTGCCCAGCCCAGTGCTACGAGAACCCAGGCTCTATTATGACAGGTTCCCCAGTCAGCAGAGGGGTTGGCCCACGCTGCTGCTGGTCTCCATGTGCCCTGCTCTCCCGGCAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC