Transcript asmbl_90117

Sequence
Transcript Sequence for observation asmbl_90117 of TGE0004379:
CGGCGACGGCGTGGAAGCCGGCGTGGCAACAGCCTGCGCGGGCGTTCTAGGGCGGGACTTCCGGCGGTGTTCGCGAGCGTCTTCCGGCTGCGCGCGAGAATTGTCCGGCCGGCATCCGGGACATGAAGGTGAGCCCCGCGGCGGCCGGCCGGGGAGGTGTCCGCGCCCCGCGTTCCGGACTCCTGCTCCTCCTCTGCACATGGCCTCAGTTCCCCTCCGCGAAGTGGGCGCGGGCGGCGCGAGGGAGAGCGGTGTGAGCGGGCGTGGACCAGAGGGGCGTGTGCGCCAGAGCGTGTGGGTGCCGGTGGGAGGCCCAGAGAGTGAGACCTTGGACGAGCGTGAGGGACCACGAACCTGAGTGGGGACAGCACACGACAGGTGGTAGGGCCCAGAGAGCGGTGGCCAACCTGTCCCAGGGGCCGAGAGGCCAGGCCGGAGTGCGGGGCAAGTGACCCCATGCTTGTTGGGGTGCACTGGGCTGGACCCCACCTCGCTCAGCCCCCAGGCTTGAAAGCGTAGATTTTCCACACAGAACAGTGATTCAACCGCTCCTCGCTTCCCAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGGTGAGCTGGTCACTACACTCCGCGCCCCCTCCGCCCAAAATAGGCCCTTGACGTGAGGGGACAGAGCTCGCTCTGACACAGGACCACGTATGTGTGAGCTAAGCAGTCGGCTCTAGGCACAGCGGCCTGGCGGACACCTGCCCAGATGCACAGTGGGGGCCATGGGAGGTGCCCAGACGAAGGCCTTGCCACAGCACGGGTACCCCGAACATTACGCAGCTCACACACGGGGTCCCCACCACCAAGCACCAGGCAGGCAGGCAGTCTGGAAAGTTCCGTGGCCAGTCAGGGAGCAGCCCAGCTCCAAATGCTTCTCTCTGGGTGCTGTAGCCCGTCACCCTAGAGCTGGCCCCCTGGGCACAGGCGGCTGTGACAGTGCCAGCCCAGGCCTCATGCCGTTTTGCCCTCCCGCTGCCCCTCGTCTGGGCACAGAGGCCAGCAAGGCCTGTCTCCCTCCAGTCTGGCCCATGTCCACCCTCTCTTCTTTCTTCTCTGCGGTGTGAAATCCCAGGTCAGGGCTCAGGCAGAGGAGTCTCGGTTCACCCGCATGGTGGTGGGGTGGCAGGCAGTGGCCGGAAGCCCCCACTTTCAGCTTGGGAAGCATCCTCCTGCTTCGTCTCATTCCTTTCAGTGCTCAGTGACTGAAACCTCCACCCTGGAGCCGAGGAGAAGCCCACAGTCGTGCAGGGGCCGGAGGGGGCTGGGGCCAAAGGCAGAGTGCCCCCCCACCATGTGGCACCTGCTAGCCCATCCCTCCCATGTGCACACTCCTCATCCAGCACATTTGTTCAGGTGTCTTTCTGGCCTCATGGTGGCTGAACTGCTCAGAGCAGCCCCCTCATAGGTTGGCAGCTGCAATCTCAGCCTGGTCAGGGGAGTGACAGGTGATTCTGGGGTCCCTCTCCCCCAGGCTGCAGTCTTTGGTGATTCTGTCAGGAGCGGGGCTGGTGGGGAGGGGCGAGGTCAGAGGGCATGATCTGGGTGTGGGTCTGCATATCCTTCCTTCACACCCCCTCGCAGCTGCCCTGTCTGTCAGGGCGAGTGCTGCCTTTCACGGGAGCTCCTTGTCCCTTCTGTCCTCAGAAGCCTTTGAGCCAGGCCATTCGTGCCTCCCAGGGAAGGGACCCCTGGGCTCTTGGCTCCAGGGCCCTGCTCTGCAGCCCATGCAGGTATGCTGTGGGTGTATAAGGTGCCACAGCACGGATGCCCACTGCCCAGGTCTCCCATCTCTCCTAGGGAAGTGACAGCCCGGAGCGGGGCGGCCTGTGCCACTCTTCAAAGGGAAGCAGGTTGAGAGGAGAGTTCAGAAGGGGCGAAGGGCCTGGCTACCAGCTCCTGACAGGCACACCCTGCCTGGTCCAGGCCCTGGTGTCACCAGGGATGTAGGGGACTGTGCGTGCCCACCTGCTGGGCAGGGGCCTAGGCCCCTCCGCTGGTCTGGAGGAAGCACATGTCAGGGCTCTGAGACTTCGCCGACGTGCTCTTCACACCTGCACGTCTTAAAGCCCTGTCAAGGATGACAGCCAGGCTGGGCCTGCTTATCGCCCAGCTGCCCTAAGAGAAAGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC