Transcript asmbl_90116

Sequence
Transcript Sequence for observation asmbl_90116 of TGE0004379:
GTGAGCCCCGCGGCGGCCGGCCGGGGAGGTGTCCGCGCCCCGCGTTCCGGACTCCTGCTCCTCCTCTGCACATGGCCTCAGTTCCCCTCCGCGAAGTGGGCGCGGGCGGCGCGAGGGAGAGCGGTGTGAGCGGGCGTGGACCAGAGGGGCGTGTGCGCCAGAGCGTGTGGGTGCCGGTGGGAGGCCCAGAGAGTGAGACCTTGGACGAGCGTGAGGGACCACGAACCTGAGTGGGGACAGCACACGACAGGTGGTAGGGCCCAGAGAGCGGTGGCCAACCTGTCCCAGGGGCCGAGAGGCCAGGCCGGAGTGCGGGGCAAGTGACCCCATGCTTGTTGGGGTGCACTGGGCTGGACCCCACCTCGCTCAGCCCCCAGGCTTGAAAGCGTAGATTTTCCACACAGAACAGTGATTCAACCGCTCCTCGCTTCCCAGGTCCCTAGAACTGAACTCAGAGAGGTCAGGGGACAGCAGTTGGTGGCACAACTGGAGCTCCAGCGGTCTGTGGCTTTCCTGTTTCCATCGCCCCGTCTTAGCGTAGGGGCCACACACCCCTCTGTCCCGCTTTGTCTTCCACGAGGGGGATGACGACAGGACTGGCCCAGGTCGTGGAGAACTCCGCCTGACGTGGTCGATAAAGGTCACCCAGGGCTGCGGCCCTGCCCCGAGGCCACCTTCGTCTCCACGGGCCATGCAGGAATTCAGTTGGTGAGAACTCGGATAGGTGACCGGTACACTCGCCATTCTGTTGAGGACCAAGTCGGCTCGGGGGCCAGACTGGTGTCAGAGACGGACACTCGGGGCACGTCAGTCGGCATTTCTCAAATTGCACGTCACTGAGTAGCGAGACCGATTTGACTGGTAGAAACCAGTGTCTTGAAAATGAAGGAGAAATGATCAACATGTGTCACATCAGGAGAGACCTGGTCAACTGCTGTCACTGCACACATGGCACGTGTGCACACACGAAGCGCACACGTGTACTGGGCTGTGGTACACTTCCTTACTGTGGATCTTGATGGAAAACACTGGAAAGTCACCGCTGTTCACTGCACTTTGGTCACACCACTGAAACGATCCTCCCCAGAGCTGGGACCCTCGAATGGTGCAAGCAGCAGGGTGCAAGCAGCAGGGTGCAAGCTCTGGGTGCAAGCAGCAGGTCCAGAGCCCTCTGGGCAACCAAAGGCCCCCTGAATCCCAAGGTTGGACCCTGCTGTGACATGCCCGCCATGAAGGCGCTCCTCAGCACACTCTGGCTTGCTCTGGCCTGTGGCTCTGTGCACACCACCCTGTCAAAGTCAGATGCCAAAAAGGCCGCCTCCAAGACACTGCTGGAGAAGACTCAGCCTTCAGAGAAGCCTGTCCAAGATCGGGGTCTGGTGGTGACGGACCCCAGACCCGAGGATGTGGTTCTCGAGCATCGTAGCTACTGCTCCGCAAAGGCACGGGAAAGGCACTTTGCTGGGGACGTCCTGGGCTACGTCACTCCATGGAACAGCCACGGCTACGACGTCGCCAAGGTGTTCGGAGGCAAGTTCACACAGATCTCGCCCGTGTGGCTGCAGCTGAAGCGGCGCGGCCGTGAGATGTTCGAGGTCACAGGCCTCCACGACGTGGACCAAGGGTGGATGCGGGCGGTCAGGAAGCAGGGCAGGGGCCTGCGCATAGTGCCTCGGCTCCTGTTTGAGGACTGGACCCGCGAGGATTTCCGGCGTGTGTGGGACAGTGAGGACGAGATAGAAGAGCTCAGCAAGGCCGTGGTCCAGGTTGCCAGGGACCAGCACTTTGATGGCTTCGTGGTGGAGGTCTGGAGCCAGCTGCTCAGCCAGAAGCACATGGGCCTCATCCACATGCTCACTCACATGGCCGAGGCGCTGCACCAGGCCCGGCTGCTGGCCATCCTCGTCATCCCACCGGCTGTCACCCCCGGGACTGAGCAGCTCGGCGTGTTCACGCACAAGGAGTTTGAGCAGCTGGCCCCCGTGCTGGACGGCTTCAGCCTCATGACTTACGACTACCCCGCAGTGCAGCAGCCTGGCCCCAATGCACCGCTGTCCTGGGTGCGAGCCTGTGTCCAGGTCCTGGACCCCAAGGCCAAGTGGCGGAGCAAGATCCTGCTGGGGCTCAACTTCTACGGCACAGACTACTCGACCTCCAGGGATGCCCGCGAGTCCGTCGTTGGGGCCAGGTACATTCAGACGCTGAAGGAGCACAGGCCCCGGATGGTGTGGGACAGCCAGGCAGCAGAGCACTTCTTCGAATATAAGAAAAGCCGCCGGGGAAGACATGTCATGTTCTACCCGACTCTGAAGTCCCTGCAGGTGCGGCTGGAGCTGGCCCGGGAGCTGGGCGTCGGGCTGTCCATCTGGGAGCTGGGCCAGGGCCTGGACTACTTCTACGACCTGCTGTAGGCCCGCCGCGGCCCAGTGCTCTTCTCAGCGGCATGCGAAATACAGACTCTTTTTTTGTC