Transcript asmbl_8989

Sequence
Transcript Sequence for observation asmbl_8989 of TGE0004782:
CCGGCTCCCCATATATAAATCGGCCATTTGCTTTGCTCCGCCCCAGAGCCTCCGAGTTCCAACCGGTTCCTAATCTAGTTCCGCAGTCGTCCGCCTTTTCTTCCTTTTCAACATGACAGATGCCGCTGTGTCCTTCGCCAAGGACTTCCTGGCAGGTGGAGTGGCTGCAGCCATCTCCAAGACGGCGGTAGCACCCATCGAGCGGGTCAAGCTGCTGCTGCAGGTGCAGCATGCCAGCAAGCAAATCACCGCAGATAAGCAGTACAAGGGCATTATAGACTGCGTGGTTCGTATCCCCAAGGAGCAGGGAGTACTATCCTTCTGGCGTGGTAACCTGGCCAATGTCATCAGATACTTCCCCACCCAGGCTCTCAACTTTGCCTTCAAAGATAAATACAAGCAGATCTTCCTAGGTGGTGTGGACAAGAGAACCCAGTTCTGGCGCTACTTTGCAGGCAATCTGGCATCAGGTGGTGCCGCTGGGGCCACCTCCTTGTGTTTTGTGTATCCTCTTGATTTTGCCCGTACCCGTCTAGCTGCTGATGTGGGCAAAGCTGGAGCTGAAAGGGAATTCAAAGGCCTCGGTGACTGCCTGGTTAAGATCTACAAATCTGATGGGATTAGGGGCCTGTACCAAGGCTTTAATGTGTCCGTGCAGGGTATTATCATCTACCGAGCTGCCTACTTCGGTATCTATGACACTGCAAAGGGAATGCTTCCAGACCCCAAGAATACTCACATCTTCATCAGCTGGATGATTGCACAGTCCGTCACTGCGGTGGCTGGGTTAACTTCCTATCCATTTGACACTGTTCGTCGTCGCATGATGATGCAGTCAGGGCGCAAAGGAACTGATATCATGTACACGGGCACGCTCGACTGCTGGAGGAAGATTGCTCGTGATGAAGGAAGCAAAGCTTTTTTCAAGGGTGCATGGTCCAACGTTCTCAGAGGCATGGGTGGTGCTTTTGTGCTTCTCTTATATGATGAAATCAAGAAGTTCACATAAGTTATTTCCTAGTCTATTTTCCCCGTGAACAGGCATGTTGTGTTATGTAACATATCTTTGAGCATTCCTGACAGACTGTTGGCTATTTATCAGTGGCAACTATTTACTGGTTGAAAATGGGAAGCAATAATATTCATCCGACCAGTTTTCTCCTAAAGCTATTTCCATGATGATCATGATAATGATGGGACTCAATTATATTTTTTATTTCAGTCACTCCTAATAATAAATTTGAAGAAATAAAAAG