Transcript asmbl_8935

Sequence
Transcript Sequence for observation asmbl_8935 of TGE0074111:
CGCCCTCCCGCCTGAGGACCTGCGGGTGCCCGCGGCGGCGCCTGACGGGAGTGGGGTCCCGGAGCGTCCTTCCGTCCTGTGCCCGCAGCCGGCGCCCTTCTCCCGAGCGTGGTCTGGGGCGGGCAAAACGCCCTCCGGATTAGTGTCGCGCAGGGTGGCGGCTGCACACACAGGCGGTGCAAGACCGCCCGCGCTAGGACCCGCCGGCCCGGAAACGCTTGCTGTCACAAAGGGGGCAACACGTGGGGGCGACGCGTGGGCGCAGACGGCCAGGGCAGCCCGGAGAACCGCCCACTGTCTCGGCCACCTGACTCCTCGGTCCCAGCCGCCAGGTCGGTCCAGCTTCGGCCGGCGCCCGGCTGTGAGGTGGACGCCCGAACTCCGTCTGATCACCTCCCTCCAGTCTTTTCCACCTGGTTCGGACGCCTGCATAATCATGTCCATCCTCTACGTCTCCCCTCACCCCGATGCCTTCCCCAGCCTCCGAGCCCTCATAGCTGCGCGCTACGGGGAGGCTGGGGAGGGGCCGGGGTGGGGAGGGGCCCACCCCCGCATCTGTCTCCAGCCGCCTCCGACGAGCAGGACTCCCTTTCCCCCACCACGTCTGCCCGCCCTGGAGCAGGGGCCCGGTGGGCTCTGGGTGTGGGGGGCTACAGCTGTGGCCCAGCTGCTGTGGCCAGCAGGTCTGGGGGGCCCTGGGGGCAGCCGGGCAGCTGTCCTCGTCCAACAGTGGGTTAGTTACGCAGACACGGAGCTAATACCAGCTGCCTGTGGGGCAACGCTGCCCGCCTTGGGACTCCGCAGCTCTGTCCAGGACCCCCAGGCTGCACTGGGGGCCCTGGGAAGAGCTCTGAGCCCCTTGGAAGAGTGGCTTCGGCTACACACCTACCTGGCTGGGGAGGCCCCCACTCTGGCTGACCTGGCGGCTGTCACAGCTTTGCTGCTGCCTTTCCGATATGTCCTGGACCCCTCTGCCCGCCGGATCTGGGGTAATGTCACTCGCTGGTTTATCACATGTGTCCAGCAGCCAGAATTCCGGGCTGTACTGGGAGAGGTGGTTCTGTACTCAGGGGCCAGGCATCTTTCCCAACAGCCAGGCCCTGAGGTCACTGCACCCCCAAAGACAGCCGGCCAACTCAAGAAAGAAGCAAAGAAACGGGAGAAGCTACAGAAATTTCAACAGAAGCAGAAGATCCAACAGCAGCAGCCACCCCTAGGGGAGAAGAAACCAAAATCAGAGAAGAGGGAGAAACGGGATCCTGGAGTCATTACCTATGACCTTCCAACCCCACCTGGGGAAAAGAAAGATGTCAGTGGCACCATGCCTGACTCCTATAGCCCTCAGTATGTGGAGGCGGCCTGGTACCCTTGGTGGGAGCAGCAGGGTTTCTTCAAGCCAGAGTATGGACGTTCCAGCGTGTCAGCACCAAATCCCCGGGGCATCTTCATGATGTGCATCCCACCCCCCAATGTGACAGGCTCCCTGCACCTGGGCCATGCGCTCACCAACGCCATCCAGGACTCCCTGACCCGATGGCACCGCATGCGTGGCGAGACGACCCTGTGGAACCCTGGCTGTGACCATGCGGGCATTGCCACCCAGGTGGTGGTGGAGAAGAAGCTGTGGCGAGAGCAGGGCCGAAATCGGCATGATTTGGGCCGTGAGGCCTTTCTACGGGAGGTCTGGAAGTGGAAGGAGGAAAAAGGTGACCGGATTTACCACCAGTTGAAGAAGCTCGGCAGTTCCTTGGACTGGGATAGAGCCTGTTTCACCATGGACCCTAAATTGTCAGCAGCTGTGATAGAGGCCTTCGTCCAGCTTCATGAGGAAGGAGTCATCTACCGCAGTACCCGCCTTGTCAACTGGTCCTGCACTCTCAACTCTGCCATCTCCGATATTGAGGTGGATAAGAAGGAGCTGACAGGTCGCACCCTGCTCTCTGTGCCTGGCTACAAGGAGAAGGTGGAGTTTGGGGTCCTCGTTTCTTTTGCCTACAAGGTCCAAGGCTCAGAGAGCAATGAGGAGGTGGTGGTGGCAACAACACGGATTGAGACAATGCTGGGAGATGTGGCCGTAGCTGTACACCCCAAAGATCCCAGATACCAGCACCTGAAGGGGAAGATCTTGATCCACCCATTCCTGTCTCGGAGCCTCCCCATCATCTTTGATGATTTTGTGGACATGGAGTTTGGCACAGGTGCGGTGAAGATCACCCCTGCACATGACCAGAATGACTATGAGGTTGGGCAGAGGCATGGGCTGGAGGCCATCAGCATCATGGACTCCCGAGGGGCCCTCATCAATGTGCCCTTGCCTTTCCTGGGCCTACCCAGGTTTGAGGCCAGGAAGGCAGTGTTGGCGGCACTGAAGGAGCAGGGACTGTTCCGTGGTATTGAGGACAACCCCATGGTGGTGCCACTTTGCAACCGGTCCAAGGATGTGGTAGAGCCTCTACTGCGGCCACAGTGGTATGTGCGCTGTGGGGAGATGGCCCAGGCCGCCAGTGCTGCTGTGACTCGGGGCGACCTTCGAATCCTGCCTGAGACCCATCAGCGGACTTGGCATGCCTGGATGGACAACATCCGGGACTGGTGCATCTCCCGGCAGCTGTGGTGGGGCCATCGCATCCCAGCCTACTTTATCACTGTCAACGACCCAACCATACCCCCAGGGGAGGACCCTGATGGGCGGTACTGGGTGAGTGGGCGCAGCGAGGCCGAGGCCCGTGAGAAGGCAGCCAAGGAATTTGGAGTGTCCCCTGACAAGATCATTCTCCAGCAAGATGAAGATGTATTGGATACCTGGTTCTCCTCTGGCCTCTTCCCCTTCTCCATCCTGGGCTGGCCCAACCAGTCAGAAGACCTGAGTGTGTTCTACCCGGGGACGCTGCTGGAGACGGGCCATGACATCCTCTTCTTTTGGGTGGCCAGGATGGTCATGCTTGGCCTGAAGCTCACTGGCAGGCTGCCCTTCAGAGAGGTCTACCTTCATGCCATCGTGCGAGATGCGCATGGCCGGAAAATGAGCAAGTCTCTGGGCAATGTCATTGACCCTCTGGATGTTATCCACGGAGTCTCCCTGCAGGGCCTCCACGACCAGTTACTGAACAGTAACCTGGATCCCAGCGAGGTGGAGAAGGCTAAAGAAGGGCAGAAGGCGGACTTCCCGGCAGGGATTCCCGAGTGTGGCACTGATGCCCTCCGGTTTGGACTGTGCGCCTACACGTCCCAGGGTCGTGACATCAACCTGGATGTGAACCGGATACTGGGATACCGCCACTTCTGCAACAAGCTTTGGAATGCCACCAAGTTTGCCCTCCGTGGTCTGGGGAAGGGTTTTGTGCCCTCAGCCACCTCCGAGCCTGGAGGCCATGAGAGCCTGGTAGACCGCTGGATCCGCAGTCGGCTGACTGAGGCCGTGAGGCTCAGCAACCAAGGTTTCCAGGCCTACGACTTCCCAGCTATCACCACCGCCCAGTACAGCTTCTGGCTGTATGAACTCTGTGATGTCTACCTGGAGTGCCTGAAGCCCGTGCTGAATGGGGTGGACCAGGCAGCCACAGAGTGCGCCTGCCAAACCCTCTATACCTGTCTGGATGTTGGCCTGCGGCTGCTCTCACCTTTCATGCCATTTGTGACCGAGGAGCTATTCCAGAGGCTGCCCCGGCGGATGCCACAAGCACCCCCTAGCCTCTGTGTCACCCCCTACCCAGAGCCTTCGGAGTGCTCCTGGAAGGACACTGAGGCAGAAGCTGCCATTGAGCTGGCCCTGAGCATCACGCGAGCCGTGCGTTCCCTGCGTGCTGACTACAACCTCATCCGGATCCGACCCGACTGTTTCCTGGAAGTGGCTGACGAGGCCACAGGTGCCCTGGCATCAGCAGTGTCAGGCTACGTGCAGGTGCTGGCCAGCGCAGGTGTGGTAGCTGTCCTGGCCCTGGGGGCTCCCGCACCCCAGGGCTGTGCTATGGCCCTGGCCTCTGACCGCTGCTCCGTCCACCTGCAGCTGCAGGGGCTGGTGGACCCGGCCCGGGAGCTAGGCAAGCTGCAGGCCAAACGTGGTGAGGCGCAGCGGCAGGCCCAGCGTCTGCGGGAACGCCGCTCCACCATGAGCTACCCAGTCAAGGTGCCCCTCAAAGTCCAGGAGGCAGATGAAGCCAAGCTCCGACAAACAGAAGCAGAGCTCAGGAAGATGGACGAGGCTATCACCCTTTTTCAGAAGATGGTGTGATACACCAGCTCCAACCCACAGTGGTCTACCATGGGACTGGCAGCAATAAATATTTTGCCACAAAAC