Transcript asmbl_87069

Sequence
Transcript Sequence for observation asmbl_87069 of TGE0004373:
CGGGATCTCGTTTCCCTAGTTCCCGAGAGCGCTTTACGGAAGGAGCCGAGTCGGTCCGGAAACAGTCGAGTGTTCCCTGGCGGGCCCTTTCCTGCCAGGTTGCATTCTGGGAAAGGGCCGTTTCCGTTAGGTACAGGAGGCTGAGGCGCGCGACCCGCCGCAGTCCCACGTGAAGGGCTACGCGAGCATCGCTCGGCGGGACAGCTCCCCGCTCGCCGCGGAGCGTCCCGGAAGCAGCGGGGAACCGGAAGTGGCCCGCGGCAGCTCAGAAGCTGATCCCGGTTCCCGGTGTGTGGCCCCTCGAAGCGCAGCGACGGCGCCATGTCCCTGATCTGCTCGATCTCCAATGAAGTGCCAGAGCACCCGTGTGTGTCCCCTGTCTCTAATCATGTCTATGAGCGGCGGCTCATTGAAAAGTATATTGCAGAGAATGGCACAGACCCCATCAACAACCAGCCTCTGTCCGAAGAGCAGCTCATCGACATCAAAGTTGCTCACCCAATCCGGCCCAAGCCTCCCTCAGCCACCAGCATCCCGGCCATTCTGAAAGCCTTACAGGACGAGTGGGATGCAGTTATGCTGCACAGCTTCACTCTGCGCCAGCAGCTGCAGACAACCCGCCAAGAGCTGTCCCACGCGCTGTACCAGCACGACGCCGCCTGCCGTGTCATTGCCCGTCTCACCAAGGAAGTCACTGCTGCCAGAGAAGCTCTGGCTACCCTGAAACCGCAGGCTGGTCTCATCGTGCCCCAGGCTGTGCCGAGTTCACAGCCAAGTGTTGTGGGTGCAGGCGAGCCCATGGATTTGGGTGAACTGGTGGGAATGACTCCCGAGATCATACAGAAGCTCCAAGATAAGGCCACTGTGCTGACCACGGAGCGTAAGAAGAGAGGGAAGACTGTGCCTGAGGAGCTGGTGAAGCCAGAAGAGCTTAGCAAATACCGTCAGGTGGCATCGCACGTGGGCTTGCACAGTGCCAGCATTCCCGGGATCCTCGCCCTGGACCTCTGCCCCTCCGACACCAACAAGATCCTCACTGGTGGGGCGGATAAAAACGTCGTCGTCTTTGACAAGAGTTCTGAGCAGATCCTGGCCACCCTCAAGGGCCACACCAAGAAAGTCACCAGTGTGGTGTTTCACCCTTCCCAGGAGCTGGTGTTTTCTGCCTCCCCAGATGCCACTATCAGGATTTGGTCTGTCCCGAACGCCTCTTGTGTACAGGTTGTTCGGGCCCATGAGAGCTCTGTGACCGGCCTCAGCCTCCACGCCACTGGCGACTATCTCCTGAGCTCCTCTGATGACCAGTACTGGGCCTTCTCTGACATCCAGACAGGGCGTGTACTCACCAAGGTGACAGATGAGACCTCTGGCTGCTCTCTCACCTGTGCGCAGTTCCATCCCGATGGGCTCATTTTTGGAACGGGAACCATGGACTCTCAGATCAAGATCTGGGACTTAAAGGAGCGCACCAACGTGGCCAACTTCCCTGGCCACTCGGGCCCCATCACCAGCATTGCCTTCTCCGAGAATGGCTACTACCTGGCCACCGCGGCCGACGACTCCTCTGTCAAGCTCTGGGATCTGCGCAAGCTTAAGAACTTTAAGACACTGCAGCTGGACAACAACTTTGAGGTGAAGTCGCTGATCTTTGACCAGAGCGGTACCTACCTGGCCCTTGGGGGCACAGATGTCCAGATCTACATCTGCAAACAGTGGACGGAGATTCTTCACTTCACAGAGCACAGCGGCCTGACCACAGGGGTGGCCTTTGGGCACCACGCCAAGTTCATCGCTTCCACGGGCATGGATAGGAGCCTCAAGTTCTACAGCCTGTAGGCCCTGTCCCCTCTGACGCAAGCTGAACCTCATCTCAGTAGTGGGGTAGAGTTAGGGTTGGGGTGGGGGGAGGAAAGGGAGAGACTGAAATGGGGGGGTCTGGGGCGGGACATTCACATCATTTCACTCTGGTCTGGGTGGTGGCCTGAGCCATGGCAGCATGGACCACCCTCATCCATGCCGCCTCCAGCCCCGACGGGAACGGATGCGGGAGGTAGAACTGTCACCCTCTGAAGGCTCGGGGTCAGGGCCTCTCCTCTCATGTCGGTCACTGAGTTGGTGGTGGCGGCCATTCCATACCCACCTCGTTTCAGTTCCTGGGAGACGGGGAGAGGCTGAGCCAAGGGAACTGTGAAGGGGTCGGGCACGAGGGCTCACGCAGGATTTTGTAAGCAGTGATCTAGTTTCATT