Transcript asmbl_86772

Sequence
Transcript Sequence for observation asmbl_86772 of TGE0004335:
GACATGTCCTTCCGAAAAGTGGTTCGGCAGAGCAAATTCCGGCATGTGTTTGGGCAGCCGGTCAAGAATGACCAGTGTTATGAGGACATCCGAGTGTCCCGTGTCACCTGGGACAGCACCTTCTGCGCTGTCAACCCCAAGTTCCTGGCAGTGATTGTGGAGGCCAGTGGTGGAGGCGCCTTCCTGGTGCTCCCTCTAAACAAGACGGGCCGCATTGACAAGGCCTACCCAACGGTGTGTGGGCACACGGGACCTGTCCTGGACATCGACTGGTGTCCCCACAACGACGAAGTCATCGCCAGCGGCTCGGAGGACTGCACAGTCATGGTGTGGCAGATCCCAGAGAATGGGCTGGCCTCCCCGCTGACAGAGCCCGTGGTGGTGCTGGAGGGGCACACCAAGCGAGTGGGCATCGTCACCTGGCACCCGACGGCCCGCAATGTGCTGCTCAGCGCAGGCTGTGACAATGTGGTGCTCATCTGGAACGTGGGCACGGCGGAGGAGCTGTACCGCTTGGACAGCCTGCACCCCGACCTCATCTACAATGTCAGCTGGAACCGCAACGGCAGCCTCTTCTGCTCCGCCTGCAAGGACAAGAGCGTGCGCATCATCGACCCCCGCCGGGGCATCCTGGTGGCGGAGCGAGAGAAGGCTCACGAGGGCGCCCGGCCCATGCGGGCCATCTTCCTGGCGGATGGCAAGGTGTTCACCACCGGCTTCAGCCGCATGAGCGAGCGGCAGCTGGCGCTCTGGGACCCAGAGAACCTCGAGGAACCAATGGCCCTGCAGGAGCTGGACTCTAGCAACGGGGCTCTGCTGCCCTTTTACGACCCTGACACCAGCGTGGTCTACGTCTGTGGCAAGGGCGATTCCAGCATCCGGTACTTTGAGATCACAGATGAGCCCCCCTACATCCACTTCCTGAACACGTTCACCAGCAAGGAGCCCCAGAGGGGCATGGGCAGCATGCCCAAGAGGGGCCTGGAGGTCAGCAAGTGCGAGATCGCCCGATTCTACAAACTGCACGAGCGCAAGTGCGAGCCTATTGTCATGACTGTGCCAAGAAAGTCGGACCTCTTCCAGGATGACCTGTACCCTGATACGGCCGGGCCCGAGGCGGCCCTGGAGGCAGAGGAGTGGGTGAGCGGGCGGGACGCCGACCCCATCCTCATCTCCCTGCGGGAGGCCTACGTGCCCAGCAAACAGCGGGACCTGAAGGTCAGCCGGCGGAACGTGTTGTCTGACAGCCGGCCTGCTGTGGCCCCGGGCTCCGCGCGCCTGGCGGCCTCCACACCTGCCACCTCCACCCATACGACTGCCCCCAGCAGCAGCCTCGCTGGGGCCGGGGAGGCTGGGAAACTGGAGGAGGTGATGCGGGAGCTGCGGGCACTGAGAGCGCTGGTCAAGGAGCAAGGGGAGCGCATCGGCCGCCTGGAGGAGCAGCTGGGCCGCATGGAGAATGGGGACGCCTAGGACCATAGGCCCAGTGGATGCCACGCCCCCTCACCTCCTCCTCCTCCACCCACTTCTCACTCAGCCTCTGCTGGCAGGCCACACCGATAGCTGGCTGCCCCCTGCCCCCTGCCCCCTGCCGAGGGCCTCTGGGGCAGGCTCGGGGCCAGCCCACACCCTGATCCATCCTGTGGGCCAGGCTGGAGCCACCGCCTGGCTTTTGTCTTTGTTACTGTGGAGGATTTTTGTACCAAGGCGAGCTTATGTGAGGGACCCTCTCTCCACACGCCCACCCGCCCCCTGCTCCCTCCCGGAGGAGTGGGAGGGATGGGCTCTATATTTTCATTCCAAATAAAATTCACTTTCTAAAA