Transcript asmbl_84331

Sequence
Transcript Sequence for observation asmbl_84331 of TGE0004288:
GGCCGCGGAGAGCCAAGAGGCGGAAGTTCCCGCGGGCTGTAAGGTCGGCGCTCGCACCGCGAATCACTTGTCAGCGCTCGTCTGAGGCGGAGGCAGCGCCGCGCCGGACCCGAGTTTCTTTCACTTTCTGGGATTGAATTTTGAGCCATCAAAACCATGAGCAACTACAGCGTGTCCTTGGTTGGTCCTGCTCCTTGGGGTTTCCGGCTGCAAGGTGGCAAAGATTTCAACATGCCTCTGACAATTTCTAGTTTAAAAGATGGCGGCAAAGCCTCCCAGGCGAATGTGAGAATAGGTGATGTGGTTCTCAGCATCGATGGAATAAGCGCCCATGGAATGACTCATCTTGAAGCCCAGAACAAGATTAAGGGTTGTACAGGCTCTTTGAATATGACTCTGCAAAGAGCATCTGCTACACCCAGGCCCGAGCCGGTTCCTGTTCAAAAGGGAGAACCTAAAGAAGTAGTTAAACCTGTACCCATTTCATCTCCTGCTGTGTCCAAAGTCACTTCCACAACCAACATGGCCTACAATAAGACACCACGGCCCTTTGGTTCTATGTCTTCACCAAAAGTCACATCCATCCCATCACCATCGTCCGCCTTCACCCCGGCCCACGCGACCACTTCATCACATGCTTCCCCTCCCGTGGCTGCTGTCACTCCTCCCCCATTCGCTGCATCTGGACTGCATGCTAATGCCAATCTTAGTGCTGACCAGCATTCACCTGCACTGAGCGCTGGTAAACCTGCAGTTAATGTCCCACGGCAGCCCACAGTCACCAGCGTGTGTTCCGAGACTGCTCAGGAGCTAGCAGAGGGACAGAGAAGAGGATCCCAGGGTGACAGTAAACAGCAAAATGGCCCACCGAGAAAACACATTGTGGACCGTAACACGGAGTTTTATCACATACCCACCCACAGCGATGCCAGCAAGAAGAGACTGATTGAGGATACAGAAGACTGGCGTCCGAGGACGGGCACAACGCAGTCTCGCTCTTTTCGAATCCTGGCCCAGATCACTGGGACTGAACATCTGAAAGAATCTGAAACTGATAATACAAAGAAGGCAAACAACACCCAGGAGCCTTCTCAGCATTTGGCTCCATCAGTAGCTTCAGCACGGAGCATGCCTGAGAGGCCAGGAAGCCCAGCCTCTGCCAGACCAGGGGTGGCTGGTCTCACAACTGCTGCTGCCTTCAAGCCTCTAGGATCCACCAGCACCATCAAGTCACCAAGCTGGCAACGGCCAAACCAAGCAGCACCTTACACTGGAAGAATCTCAAATAGTGCAGCTTCCTCAGGAGCAGTGGGACCAGCCGCCTCCTCTGTGGGGCAGCCCCAGCCAAGTGACCAGGACACTTTAGTGCAACGAGCTGAGCACATTCCAGCAGGAAAACGAACTCCAATGTGTGCCCACTGTAACCAGGTCATCAGGGGACCATTTCTAGTGGCACTGGGGAAATCTTGGCACCCAGAAGAATTCAACTGTGCTCACTGCAAAAATACAATGGCCTACATTGGATTTGTGGAGGAAAAGGGGGCCCTGTATTGTGAGCTCTGCTATGAGAAATTCTTTGCTCCTGAATGCGGTCGATGCCAAAGGAAGATCCTTGGAGAAGTCATCAATGCTTTGAAACAAACTTGGCATGTTTCCTGTTTTGTGTGTGTGGCCTGTGGAAAACCCATTCGTAATAATGTTTTTCACTTGGAGGATGGTGAACCCTATTGTGAGACGGATTATTATGCCCTCTTTGGTACTATATGCCGTGGATGTGAATTTCCCATAGAAGCTGGCGACATGTTTCTGGAGGCTCTGGGCTATACCTGGCATGACACTTGCTTCGTATGCTCAGTATGTTGTGAAAGTTTGGAAGGTCAGACCTTTTTCTCCAAGAAGGACAAGCCTCTTTGCAAGAAACATGCTCATGCTGTGAATTTTTGAAAGTCAACAGTTCAAGAGAAGAGAAGAAATTTGAAAAGAAAGAGGAGAATTAAAATTACCAATTAATTTTTAGATTTAATATTTATATGGAGTTTGAAAAATAATAGTGGCCCTGAAGGGATAAATTCCAGCTTTAAAAACCGAGTCTTTGAAGAAATATTTGGCTACATAACGTAAAGAGACAGTTTGGCATTTATTATTACTTTTTTCCCTGTATTTTCTGCCCATAAAATAACTTTCATAAAAATCAATTTCCTGGTTGACTATTAAATTCATCTTAGAATAAATTAGTAAAGAATTAAATTTTAGAAAATCTCAAACCTCTATGCTGAAATAATTATGGTTTCTTTCCTTGTTATGAGTAAATCTGTAAAAGGCAATGAAAGTGCCTTATACTTTTATCATTAAATGAAACATTGTATTTTTTTTAAGAATAATGTTTATCTTTAAAACAGTAAATAGGAGTTTAAACAGAGCATTTTATCAGTAGGTGTCAATTTTTACAAACTGTGTACATTTTTTTTGTCTTACAATCGATCATTCCAGTAGGAAAGATCAATGAGATTTTTCATCAAAATGCATCATGCCAATAAGAGATGCTATATTTTTCTTCATCCCTTTCAAAAGCTACCTACCATATGGCTTATAAATCTCAAATTTTTGCCTTTTATTAAAATATGGCCATTCCTATTCATTGTGTGTGTTTTATCGCCTATATTAGTCAAACTCTTTTTACCCCCGCTCCTTCATGCTGAGGTAAAGAGCTAATTGGATAACTTTGGACTGTAACAGTTTTCTCTCTATATAAAGAGAATAAGTAGGAAAGAATGTGGTTGTATCCAAAATATTCTCCTCCCCAATTCAGATCATGAATCGGTTTCAGAGTTGTACTACTGACAAGTGAAGGTTTGAGAACTCTCTTTGCAGAGTATTTTTTTCTTTAATTCTACATTAGAAAAATAAAAGATTGGCTTGGGGATGTGATAAAATCTTGATTGTTTTTTTCTTTTGATCATTCTCTTTCAGTAATAAATGAACCACTTCTAAAGGTGATCATGAAGTTTGGAAACTTTTATTCACAGAGGTTTGGTAGTATAGGAGGGCATATGATTAATTACTCAGACTAGCCCATTATTTGTTTTCTTCATTTGGGGAAAATTATGTGGATACCACATGAAGACAGAGAAACAATTGTGGTAAAATTGTAGATCCTATTGATATTTGCCCAGTGAGAAAAGCAATTATGGCATTTGATAGTTTTTCTCTTTGTTTTCAGATATGATGAAAGCCCATGATCCCACTAAGTTATAATTTAAATTCATTTGGAGCAAGATGCTTTTAAAGTTGAGGCTGAACCCGAAGTCTTTCCTGCCCCATCATCACTCACTAATTACTTCACTTCCATTGTGTACATGTTTGTTATAGAGGGAGGTTTTAAGCTACAATATTTGTTTAACCTCCCTAAGAACTTTTCAAGGCATCTGTCCTGAAAGTTGTTAATATATGGTCTAGCAGATTTAAATTATATACAGATAATAATTAACTGGGGATAAAAGAATGAGAAGGATGACACAAAGTGGCAAACTGAATACTTCACTTATAGTAACCCCAAACCACCTCCTCACCTTGCATCTTGCAGGGAGGCAGGAAGTTTTTTTGTTTTTTTTGTTTTTTAAGTGCTGTAACTGAATCATGCATTATTTTTCATTGCTGCTGAAACTACCTATAGAAGACATGCTGGCTAATGTGCCTTGTCACATATCTTGATGTCAGCCTTTTGCTTCACACAGCATAAAATAAGTTGGTGGTTTTGTTTTGATGTGGTAGAAGTTTTTTTTGTTATTTAGTTTTGCATTTATGGATTTTATATACAAAAATTGTATTTGGTAAGTCAGTGGTAGTTCCTTCAAAGAATTTTATTTGACCTGGGTTTCTTATAAAGTTATATTAACAATATCATTTTTATAGACTTTTCTTTCTACATATTATTCATGGAGCATAATGTTGCATTTCTCTAAATTTTATCTCGAAAAAGGTAACATTACATCCTAATTTATCATTTTGTCTTTGTGCTTTGTCCTTCTCTTCTGTGACAGAGCTTTATATCTATAACTAAAACAGTTAATCCTGTGAAATAAATATTGATCATAACCCAGAAGAATCTCTATTTTCCAGTGGGGAATGCCATATTTAACATACCAGCATTAATCTTTTAATAACTGGCAGAGCACTTTATTCTTCTGGCGAGCTCCCTGAATATTTATTTTTCTGATTATAAATATTCCGAGTCAGTAGCATTTTTTAAATTATTACGTCTTCACTGTAGAGCATTTACTTTTAGTCTCTTTAGATGTATATTTTGAAATGCTGTACTTAGTATAATATAGATTAAAATCATAGTACATAACTTTAAAACATCCCTTATTTGGATTTCTCTGTTTCAAAATGCTAGTGATAGGTTCAAATTTCTCTAGACTTACAAGGACAGAACGTTGCCCGCCATAGTAGCAGCCAAAAAATGGTCTTCTGTGCTTATGTTTATAGTAGCTTACACATTTCTATTGATTCAGGTTACATTAAGAATCTAAAACTAAAACTTAATTGTCTGGTCAGTATTAAGACAAACAAATAGTTTTAATCTTCAAATTATTAGTGCAGCATTATGTTTAAAAATTACCTACGACAAAATGTGTTAATGATACCATTTTCAAGGGGTACTATATTAGGACCACTTTTATAGAAAATAATTCCTCGGCCTCCGAATCTAGTAGTATGTTAACATTTTTGTGATGATTCAAAGGAGAGGCTTTTCAGACATAGGGAAGGGAAAACATACTGAATAATTTCACACAGATCTAACGTGGCTTCAGTTTGTCACTCTTCATCCCCTAATGTTTTAAGGTATTGGGTTTGAATTCTCAATGTATCATTTGCCTTATCTATTAATCTCTACTTTCTGTTTCTTTACGTTTTTAATTTTATATACGTCTATGCTGTTTTGCTTTTGCTTTTGGATGTATTTTCTAATTAAAAACCATGTGAGAAGTGTAATCAGTATAGTAATACCTTAATGAGCACATAATAAATAAATGGCTGCAGTGATGTAGACAAGCTCTCTTGGTTTTTCTTTTGGGGTGGCAAGTGGTTTCTAGTAAGTTATCGTGGGAAAAAACTGAGTTCACAGAACAGGAAGAGGTGTATTAATTCTCAGGAGAATCTCTTTCTTATCTTTGATTTGCCTATCAGAATGTCCAGAAATAAAACATTTGGAAATATGGTCACATTTATTCTACTTTAATCCTTTATTTAAAGCTTTATTCTCCGCATATAGTGTACATACAAATGTTTGTGAATTGATGAATAACCTCTATTGTCTTTTAAAAATTTTCATTATTGAAATTATTTATGGCAGGAGTATCCTGTTGTATCAAGCGTTATATTGTATTATATATCGTATTCAAACGACTTAAGTCATCATCTATATTTTCACATTTTTCATTGACCTGGGTCCGTTACTTCATGCATAACACGTCCGATCTCATTAGCTAACTTTATTCTATAACTAG