Transcript asmbl_81369

Sequence
Transcript Sequence for observation asmbl_81369 of TGE0074024:
GTTGGGACTTCGGGGCCTACCCTGTCCGGACCCGGGAGCTGGGAGGCGGCGAGACCGGTCTGCGCCCCCGAGAGGACGAGTCACCAGGTTTCAAGATGCTGCGAGTACGTAGGACCGAGCTGTGCAGGTTGGGGCTCGGCCTCTCCAGGGGGCTTCACCAACAGCCTGTGATGGCCCTGAGGCGGGAGGACGTGAACGCCTGGGAGAGGAGGGCCCCTCTGGCCCCCAGGCACATCAAGGGGATCACCAACCTGGGATACAAGGTCTTAATACAGCCTTCCAATCGGCGGGCCATTCATGATAAGGAATATGTCAAAGCTGGTGGCATTCTTCAGGAGGATATTTCTGAAGCCTGTCTAATTTTGGGAGTTAAAAGACCCCCAGAGGATAAATTAATGTCCAAGAAGACTTATGCATTCTTCTCCCACACAATAAAGGCCCAGGAGGCCAATATGGGCTTATTGGATGAGATTCTAAGACAGGAAATCCGACTTATTGATTATGAAAAAATGGTGGATCATAGAGGAATTCGGGTAGTGGCGTTTGGACAGTGGGCTGGTGTGGCAGGGATGATCAACATTTTACATGGAATGGGTTTAAGGCTCCTTGCTTTGGGACATCATACACCTTTTATGCACATTGGCATGGCTCATAACTATAGGAACAGCAGTCAGGCTGTGCAAGCTGTCCGTGATGCTGGCTATGAAATATCTCTGGGTTTGATGCCCAAGTCAATAGGGCCCTTAACATTTGTGTTCACAGGGACTGGCAATGTATCAAAGGGAGCCCAAGAAGTCTTCAATGAACTACCCTGTGAATATGTGGAACCACATGAATTAAAAGAAGTTTCTAAAACTGGTGACCTGAGAAAAGTGTATGGAACAGTGTTAAGTCGCCATCATCATCTTGTCAGGAAAACAGATGGTACATATGATCCCGTAGAATATGACAAATATCCTGAGCGCTACATAACTCGTTTTAATACCGATATTGCACCCTATACAACTTGTTTTATTAATGGAATCTACTGGGAGCAAAACACCCCTCGTCTACTAACCCGCCAAGATGCTCAAAGCCTCCTGGCTCCAGTCAAGTCTTCAGTTGTCGGTGTGGAAGGCTGCCCTGCATTGCCACACAA